Transcript: Mouse NM_145829.2

Mus musculus N-acetylglutamate synthase (Nags), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Nags (217214)
Length:
2122
CDS:
75..1658

Additional Resources:

NCBI RefSeq record:
NM_145829.2
NBCI Gene record:
Nags (217214)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076077 CCTCGGTTGCACTCGATCTAT pLKO.1 1290 CDS 100% 5.625 7.875 N Nags n/a
2 TRCN0000076075 CCGCAGTCATTACAGCCGCTA pLKO.1 1096 CDS 100% 0.720 1.008 N Nags n/a
3 TRCN0000076076 CGAACTAGTCAATCATGCCAA pLKO.1 1589 CDS 100% 0.000 0.000 N Nags n/a
4 TRCN0000076073 GCTCTACCTAAGGTAACCTTA pLKO.1 1899 3UTR 100% 4.950 3.960 N Nags n/a
5 TRCN0000423825 AGAGACCTGCAAACGTTGTTC pLKO_005 1449 CDS 100% 4.950 3.465 N Nags n/a
6 TRCN0000076074 GCGGAATAACAGTCAGAAGAT pLKO.1 950 CDS 100% 4.950 3.465 N Nags n/a
7 TRCN0000413682 CGCTGACCTTGACCTTGTTAC pLKO_005 992 CDS 100% 10.800 6.480 N Nags n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13325 pDONR223 100% 59.9% 64.8% None (many diffs) n/a
2 ccsbBroad304_13325 pLX_304 0% 59.9% 64.8% V5 (many diffs) n/a
3 TRCN0000470947 TTCGCTAATCATTAAAAAAACGGA pLX_317 16.5% 59.9% 64.8% V5 (many diffs) n/a
Download CSV