Transcript: Human NM_153006.3

Homo sapiens N-acetylglutamate synthase (NAGS), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NAGS (162417)
Length:
2114
CDS:
43..1647

Additional Resources:

NCBI RefSeq record:
NM_153006.3
NBCI Gene record:
NAGS (162417)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153006.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045838 GCAGTCATAAGGTCCTGAGTA pLKO.1 947 CDS 100% 4.950 6.930 N NAGS n/a
2 TRCN0000045839 CCCTGGTACTTCAAACACAGT pLKO.1 1489 CDS 100% 2.640 2.112 N NAGS n/a
3 TRCN0000045840 CGCTGCTCACTGAGCTCTTTA pLKO.1 1109 CDS 100% 13.200 9.240 N NAGS n/a
4 TRCN0000045842 CCTGCGCGACAGCAGTCATAA pLKO.1 936 CDS 100% 4.400 3.080 N NAGS n/a
5 TRCN0000045841 CCTGGCCTTCTTGCAGCGCAT pLKO.1 522 CDS 100% 0.000 0.000 N NAGS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153006.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13325 pDONR223 100% 68.9% 68.9% None 1_498del n/a
2 ccsbBroad304_13325 pLX_304 0% 68.9% 68.9% V5 1_498del n/a
3 TRCN0000470947 TTCGCTAATCATTAAAAAAACGGA pLX_317 16.5% 68.9% 68.9% V5 1_498del n/a
Download CSV