Construct: ORF TRCN0000470966
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000974.1_s317c1
- Derived from:
- ccsbBroadEn_14137
- DNA Barcode:
- CTTGTTTCGCCATACTCACATAAT
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- COPS4 (51138)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470966
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51138 | COPS4 | COP9 signalosome subunit 4 | NM_016129.3 | 99.9% | 99.2% | 1210delA |
2 | human | 51138 | COPS4 | COP9 signalosome subunit 4 | NM_001330727.2 | 90% | 81.1% | (many diffs) |
3 | human | 51138 | COPS4 | COP9 signalosome subunit 4 | NM_001258006.2 | 86.7% | 83.7% | 1002_1003ins85;1056_1057ins76 |
4 | mouse | 26891 | Cops4 | COP9 signalosome subunit 4 | NM_012001.2 | 90.5% | 98.7% | (many diffs) |
5 | mouse | 26891 | Cops4 | COP9 signalosome subunit 4 | XM_006534955.1 | 78.8% | 82.7% | (many diffs) |
6 | mouse | 26891 | Cops4 | COP9 signalosome subunit 4 | XM_006534953.2 | 78.7% | 86.4% | (many diffs) |
7 | mouse | 26891 | Cops4 | COP9 signalosome subunit 4 | XM_006534954.3 | 78.7% | 86.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1284
- ORF length:
- 1218
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcagccgtg cgacaggatt tggcccagct catgaattcg agcggctctc 121 ataaagatct ggctggcaag tatcgtcaga tcctggaaaa agccattcag ttatctggag 181 cagaacaact agaagctttg aaagcttttg tggaagcaat ggtaaatgag aatgtcagtc 241 tcgtgatctc gcggcagttg ctgactgatt tttgcacaca tcttcctaac ttgcctgata 301 gcacagccaa agaaatctat cacttcacct tggaaaagat ccagcctaga gtcatttcat 361 ttgaggagca ggttgcttcc ataagacagc atcttgcatc tatatatgag aaagaagaag 421 attggagaaa tgcagcccaa gtgttggtgg gaattccttt ggaaacagga caaaaacagt 481 acaatgtaga ttataaactg gagacttact tgaagattgc taggctatat ctggaggatg 541 atgatccagt ccaggcagag gcttacataa atcgagcatc gttgcttcag aatgaatcaa 601 ccaatgaaca attacagata cattataagg tatgctatgc acgtgttctt gattatagaa 661 gaaaattcat tgaagctgca caaaggtaca atgagctctc ttacaagaca atagtccacg 721 aaagtgaaag actagaggcc ttaaaacatg ctttgcactg tacgatctta gcatcagcag 781 ggCAGCAGCG TTCTCGGATG CTAGCTACTC TTTTTAAGGA TGAAAGGTGC CAGCAACTTG 841 CTGCCTATGG GATCCTAGAG AAAATGTATC TAGATAGGAT CATCAGAGGA AATCAACTTC 901 AAGAATTTGC TGCCATGCTG ATGCCTCACC AAAAAGCAAC TACAGCTGAT GGTTCCAGCA 961 TCTTGGACAG AGCTGTTATT GAACACAATT TGTTGTCTGC AAGCAAATTA TATAATAATA 1021 TTACCTTCGA AGAACTTGGA GCTCTTTTAG AGATCCCTGC AGCTAAGGCG GAAAAGATAG 1081 CATCTCAAAT GATAACCGAA GGACGTATGA ATGGATTTAT TGACCAGATT GATGGAATAG 1141 TTCATTTTGA AACACGAGAA GCCCTGCCAA CGTGGGATAA GCAGATCCAA TCACTTTGTT 1201 TCCAAGTGAA TAACCTTTTG GAGAAAATTA GTCAAACAGC ACCAGAATGG ACAGCACAAG 1261 CCATGGAAGC CCAGTGGCTC AGTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA 1321 GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT 1381 TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACT TGTTTCGCCA 1441 TACTCACATA ATACGCGTTA AGTCgacaat caacctctgg attacaaaat ttgtgaaaga 1501 tt