Transcript: Human NM_001258006.2

Homo sapiens COP9 signalosome subunit 4 (COPS4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
COPS4 (51138)
Length:
1566
CDS:
43..1101

Additional Resources:

NCBI RefSeq record:
NM_001258006.2
NBCI Gene record:
COPS4 (51138)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118343 CGAGCATCGTTGCTTCAGAAT pLKO.1 550 CDS 100% 4.950 3.960 N COPS4 n/a
2 TRCN0000118345 CGTGGGATAAGCAGATCCAAT pLKO.1 1063 CDS 100% 4.950 3.960 N COPS4 n/a
3 TRCN0000288734 CGTGGGATAAGCAGATCCAAT pLKO_005 1063 CDS 100% 4.950 3.960 N COPS4 n/a
4 TRCN0000296028 TATGCTGGATTCCGTTTAAAG pLKO_005 1286 3UTR 100% 13.200 9.240 N COPS4 n/a
5 TRCN0000296027 TGAAGATTGCTAGGCTATATC pLKO_005 488 CDS 100% 13.200 9.240 N COPS4 n/a
6 TRCN0000118346 GAGGAAATCAACTTCAAGAAT pLKO.1 863 CDS 100% 5.625 3.938 N COPS4 n/a
7 TRCN0000288805 GAGGAAATCAACTTCAAGAAT pLKO_005 863 CDS 100% 5.625 3.938 N COPS4 n/a
8 TRCN0000118344 GCTTCCATAAGACAGCATCTT pLKO.1 352 CDS 100% 4.950 3.465 N COPS4 n/a
9 TRCN0000118342 AGGTGAAATATCTGTGGCTAA pLKO.1 1421 3UTR 100% 4.050 2.835 N COPS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14137 pDONR223 100% 86.7% 83.7% None 1002_1003ins85;1056_1057ins76 n/a
2 ccsbBroad304_14137 pLX_304 0% 86.7% 83.7% V5 (not translated due to frame shift) 1002_1003ins85;1056_1057ins76 n/a
3 TRCN0000470966 CTTGTTTCGCCATACTCACATAAT pLX_317 41.3% 86.7% 83.7% V5 (not translated due to frame shift) 1002_1003ins85;1056_1057ins76 n/a
Download CSV