Construct: ORF TRCN0000471041
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014142.1_s317c1
- Derived from:
- ccsbBroadEn_07296
- DNA Barcode:
- ACTAGGCTCGATTCAAGTCTCTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NAPG (8774)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471041
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8774 | NAPG | NSF attachment protein gamma | NM_003826.3 | 99.8% | 99.6% | 441A>T |
2 | human | 8774 | NAPG | NSF attachment protein gamma | XM_011525754.2 | 79.1% | 79.3% | (many diffs) |
3 | human | 8774 | NAPG | NSF attachment protein gamma | XM_011525756.2 | 73.6% | 73.3% | 0_1ins246;195A>T |
4 | human | 8774 | NAPG | NSF attachment protein gamma | XM_017026063.2 | 72.5% | 72.1% | 0_1ins255;2T>A;186A>T |
5 | mouse | 108123 | Napg | N-ethylmaleimide sensitive ... | NM_028017.1 | 88.1% | 97.7% | (many diffs) |
6 | mouse | 108123 | Napg | N-ethylmaleimide sensitive ... | XM_011246806.2 | 76% | 84.2% | (many diffs) |
7 | mouse | 108123 | Napg | N-ethylmaleimide sensitive ... | XM_011246807.2 | 55% | 61.6% | (many diffs) |
8 | mouse | 108123 | Napg | N-ethylmaleimide sensitive ... | XM_011246808.2 | 53.7% | 60.2% | (many diffs) |
9 | mouse | 108123 | Napg | N-ethylmaleimide sensitive ... | XM_011246809.2 | 53.7% | 60.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1002
- ORF length:
- 936
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggctcagaag ataaacgagg ggctggaaca cctcgccaaa gcagagaaat 121 acctgaaaac tggtttttta aaatggaagc cagattatga cagtgccgct tctgaatatg 181 gaaaagcagc tgttgctttt aaaaatgcca aacagtttga gcaagcaaaa gatgcctgcc 241 tgagggaagc tgttgcccat gaaaataata gggctctttt tcatgctgcc aaagcttatg 301 agcaagctgg aatgatgttg aaggagatgc agaaactacc agaggccgtt cagctaattg 361 agaaggccag catgatgtat ctagaaaacg gcaccccaga cacagcagcc atggctttgg 421 agcgagctgg aaagcttata gaaaatgttg atccagagaa ggctgtacag ttatatcaac 481 agacagctaa tgtgtttgaa aatgatgaac gcttacgaca ggcagttgaa ttactaggaa 541 aagcctccag actactagta cgaggacgta ggtttgatga ggcggCACTC TCTATTCAGA 601 AAGAAAAAAA TATTTATAAG GAAATTGAGA ATTATCCAAC TTGTTATAAG AAAACAATTG 661 CTCAAGTCTT AGTTCATCTA CACAGAAATG ACTATGTAGC TGCAGAAAGA TGTGTCCGGG 721 AGAGCTATAG CATCCCTGGG TTCAATGGCA GTGAAGACTG TGCTGCCCTG GAACAGCTTC 781 TTGAAGGTTA TGACCAGCAA GACCAAGATC AGGTGTCAGA TGTCTGCAAC TCACCGCTTT 841 TCAAGTACAT GGACAATGAT TATGCTAAGC TGGGCCTGAG TTTGGTGGTT CCAGGAGGGG 901 GAATCAAGAA GAAATCACCT GCAACACCAC AGGCCAAGCC TGATGGTGTC ACTGCCACGG 961 CTGCTGATGA AGAGGAAGAT GAATACTCAG GAGGACTATG CTACCCAACT TTCTTGTACA 1021 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1081 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1141 AGGACGAACT AGGCTCGATT CAAGTCTCTC AACGCGTTAA GTCgacaatc aacctctgga 1201 ttacaaaatt tgtgaaagat t