Transcript: Mouse XM_011246809.2

PREDICTED: Mus musculus N-ethylmaleimide sensitive fusion protein attachment protein gamma (Napg), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Napg (108123)
Length:
3508
CDS:
191..1018

Additional Resources:

NCBI RefSeq record:
XM_011246809.2
NBCI Gene record:
Napg (108123)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225761 CCGGAAAGCTCATAGAGAATG pLKO_005 291 CDS 100% 10.800 15.120 N Napg n/a
2 TRCN0000225762 TACAGCATACCAGGCTTTAAC pLKO_005 740 CDS 100% 13.200 10.560 N Napg n/a
3 TRCN0000219106 GAACTACCCAACTTGTTATAA pLKO_005 493 CDS 100% 15.000 10.500 N Napg n/a
4 TRCN0000225763 GCCCTTGTGTGTGACTATAAA pLKO_005 1976 3UTR 100% 15.000 10.500 N Napg n/a
5 TRCN0000254124 GATGAAGCTGCACTGTCTATT pLKO_005 440 CDS 100% 13.200 9.240 N Napg n/a
6 TRCN0000254123 ATCTACACAGAAATGACTATG pLKO_005 690 CDS 100% 10.800 7.560 N Napg n/a
7 TRCN0000225760 CAGTGCAGCTGATCGAGAAAG pLKO_005 210 CDS 100% 10.800 7.560 N Napg n/a
8 TRCN0000254126 ATGGACAATGATTACGCTAAG pLKO_005 863 CDS 100% 6.000 4.200 N Napg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07296 pDONR223 100% 53.7% 60.2% None (many diffs) n/a
2 ccsbBroad304_07296 pLX_304 0% 53.7% 60.2% V5 (many diffs) n/a
3 TRCN0000471041 ACTAGGCTCGATTCAAGTCTCTCA pLX_317 44.6% 53.7% 60.2% V5 (many diffs) n/a
Download CSV