Transcript: Human XM_017026063.2

PREDICTED: Homo sapiens NSF attachment protein gamma (NAPG), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAPG (8774)
Length:
3272
CDS:
40..723

Additional Resources:

NCBI RefSeq record:
XM_017026063.2
NBCI Gene record:
NAPG (8774)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026063.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380044 AGGGATATCCGTACTTCATTA pLKO_005 800 3UTR 100% 13.200 18.480 N NAPG n/a
2 TRCN0000029168 CGACAGGCAGTTGAATTACTA pLKO.1 235 CDS 100% 5.625 7.875 N NAPG n/a
3 TRCN0000029165 GCCAGCATGATGTATCTAGAA pLKO.1 85 CDS 100% 4.950 6.930 N NAPG n/a
4 TRCN0000382300 AGGTGATGTTTACTGATAAAT pLKO_005 1127 3UTR 100% 15.000 10.500 N NAPG n/a
5 TRCN0000382126 GAGAATTATCCAACTTGTTAT pLKO_005 346 CDS 100% 13.200 9.240 N NAPG n/a
6 TRCN0000380721 GAGCGAGCTGGAAAGCTTATA pLKO_005 139 CDS 100% 13.200 9.240 N NAPG n/a
7 TRCN0000254123 ATCTACACAGAAATGACTATG pLKO_005 395 CDS 100% 10.800 7.560 N Napg n/a
8 TRCN0000380644 GGGTAATAAGCATAGGTATTC pLKO_005 1038 3UTR 100% 10.800 7.560 N NAPG n/a
9 TRCN0000029164 GCTCAAGTCTTAGTTCATCTA pLKO.1 379 CDS 100% 4.950 3.465 N NAPG n/a
10 TRCN0000029167 GCACTCTCTATTCAGAAAGAA pLKO.1 304 CDS 100% 5.625 3.375 N NAPG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026063.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07296 pDONR223 100% 72.5% 72.1% None 0_1ins255;2T>A;186A>T n/a
2 ccsbBroad304_07296 pLX_304 0% 72.5% 72.1% V5 0_1ins255;2T>A;186A>T n/a
3 TRCN0000471041 ACTAGGCTCGATTCAAGTCTCTCA pLX_317 44.6% 72.5% 72.1% V5 0_1ins255;2T>A;186A>T n/a
Download CSV