Construct: ORF TRCN0000471179
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000519.1_s317c1
- Derived from:
- ccsbBroadEn_14024
- DNA Barcode:
- GACGGCAGCCTAGACAAAGCGAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGAP32 (9743)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471179
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9743 | ARHGAP32 | Rho GTPase activating prote... | XM_017018597.2 | 45.2% | 42.6% | (many diffs) |
| 2 | human | 9743 | ARHGAP32 | Rho GTPase activating prote... | XM_017018596.1 | 15% | 14.1% | (many diffs) |
| 3 | human | 9743 | ARHGAP32 | Rho GTPase activating prote... | XM_011543075.2 | 14.8% | 13.4% | (many diffs) |
| 4 | human | 9743 | ARHGAP32 | Rho GTPase activating prote... | XM_011543072.2 | 14.6% | 13.7% | (many diffs) |
| 5 | human | 9743 | ARHGAP32 | Rho GTPase activating prote... | XM_017018595.2 | 14.6% | 13.7% | (many diffs) |
| 6 | human | 9743 | ARHGAP32 | Rho GTPase activating prote... | XM_011543073.2 | 14.5% | 13.6% | (many diffs) |
| 7 | human | 9743 | ARHGAP32 | Rho GTPase activating prote... | NM_001142685.1 | 14.4% | 13.5% | (many diffs) |
| 8 | human | 9743 | ARHGAP32 | Rho GTPase activating prote... | XM_005271736.4 | 14.3% | 13.4% | (many diffs) |
| 9 | human | 9743 | ARHGAP32 | Rho GTPase activating prote... | NM_014715.4 | 13.5% | 12.4% | (many diffs) |
| 10 | mouse | 330914 | Arhgap32 | Rho GTPase activating prote... | XM_006510445.3 | 13.7% | 13.6% | (many diffs) |
| 11 | mouse | 330914 | Arhgap32 | Rho GTPase activating prote... | XM_011242560.2 | 13.7% | 13.6% | (many diffs) |
| 12 | mouse | 330914 | Arhgap32 | Rho GTPase activating prote... | NM_001195632.1 | 13.5% | 13.5% | (many diffs) |
| 13 | mouse | 330914 | Arhgap32 | Rho GTPase activating prote... | XM_006510442.2 | 13.4% | 13.4% | (many diffs) |
| 14 | mouse | 330914 | Arhgap32 | Rho GTPase activating prote... | NM_177379.4 | 12.6% | 12.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1032
- ORF length:
- 966
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc cccgaaagtg ttaagcacat ggtggagagg caagcacgga ttccaggtgg 121 gactcttccc tggacactgt gttgagttaa ttaaccaaaa agttccccag tcagtgacca 181 actcagtgcc aaaaccagtg tctaaaaagc acggcaagct cattacgttc ttacgaacat 241 tcatgaagtc tcgtccaaca aaacagaagc tgaagcagcg gggaatcttg aaagagaggg 301 tgtttggttg tgacctgggg gagcaccttc taaattctgg ttttgaagtg ccgcaggttc 361 ttcaaagctg cacagcattc attgagagat atggcatcgt ggatggaatc tatcgccttt 421 ctggtgttgc ctccaatatc cagagactac gccatgaatt tgactctgag cacgtccccg 481 acctgacgaa agaaccgtat gttcgggaca tccattctgt gggttcccta tgtaagctgt 541 acttccggga actcccaaac cctctgctta cctaccagct gtatgagaaa ttttcTGATG 601 CAGTTTCAGC AGCAACAGAT GAAGAAAGGC TGATAAAAAT CCACGATGTC ATCCAGCAGC 661 TCCCCCCACC ACACTACAGA ACACTGGAGT TCCTGATGAG ACACTTGTCT CTTCTAGCTG 721 ACTATTGTTC CATCACAAAT ATGCATGCAA AAAATCTAGC AATTGTTTGG GCTCCAAACC 781 TGTTAAGATC AAAACAGATA GAATCTGCCT GCTTCAGTGG AACAGCAGCT TTCATGGAAG 841 TGAGGATTCA GTCTGTGGTT GTTGAGTTCA TCCTGAATCA CGTTGATGTG CTGCTGCCAC 901 ACTTCAGCGC ACGCACAGAA CTAATCGTCC CCTTCCCCCT CCGCCTTCTC AGAAAACAGT 961 TTACTCCTCC TTTGCTAGGC CCGATGTCAC CACTGAACCC TTTGGTCCAG ATAACTGTTT 1021 GCATTTCAAT ATGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1081 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1141 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGAC GGCAGCCTAG ACAAAGCGAG 1201 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t