Transcript: Mouse XM_011242560.2

PREDICTED: Mus musculus Rho GTPase activating protein 32 (Arhgap32), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap32 (330914)
Length:
6467
CDS:
125..6316

Additional Resources:

NCBI RefSeq record:
XM_011242560.2
NBCI Gene record:
Arhgap32 (330914)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105660 CCGGTGCAATTCCTATGACAA pLKO.1 2284 CDS 100% 4.950 6.930 N Arhgap32 n/a
2 TRCN0000105661 CGGTGCAATTCCTATGACAAT pLKO.1 2285 CDS 100% 4.950 6.930 N Arhgap32 n/a
3 TRCN0000105664 GCAGATCAATGGACTCGGAAA pLKO.1 3379 CDS 100% 4.050 5.670 N Arhgap32 n/a
4 TRCN0000048359 CCAGTTAGATTATGGGTCCAA pLKO.1 5761 CDS 100% 2.640 3.696 N ARHGAP32 n/a
5 TRCN0000105663 CGGATGAAGAACGGTTGATAA pLKO.1 1467 CDS 100% 13.200 9.240 N Arhgap32 n/a
6 TRCN0000105662 GCATTTCAATATGACTCCAAA pLKO.1 4531 CDS 100% 4.950 3.465 N Arhgap32 n/a
7 TRCN0000048360 GCCTCCAATATCCAGAGACTA pLKO.1 1280 CDS 100% 4.950 3.465 N ARHGAP32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14024 pDONR223 100% 13.7% 13.6% None (many diffs) n/a
2 ccsbBroad304_14024 pLX_304 0% 13.7% 13.6% V5 (many diffs) n/a
3 TRCN0000471179 GACGGCAGCCTAGACAAAGCGAGT pLX_317 45.3% 13.7% 13.6% V5 (many diffs) n/a
Download CSV