Transcript: Human XM_017018596.1

PREDICTED: Homo sapiens Rho GTPase activating protein 32 (ARHGAP32), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP32 (9743)
Length:
10337
CDS:
464..6490

Additional Resources:

NCBI RefSeq record:
XM_017018596.1
NBCI Gene record:
ARHGAP32 (9743)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018596.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416295 TCCGAAGATAGGACGGAAATT pLKO_005 2902 CDS 100% 13.200 18.480 N ARHGAP32 n/a
2 TRCN0000048358 CCTCCTAATTTACCTAGCGAT pLKO.1 3935 CDS 100% 2.640 3.696 N ARHGAP32 n/a
3 TRCN0000048361 CCAGCAGTTCAAATTATCATT pLKO.1 4530 CDS 100% 5.625 3.938 N ARHGAP32 n/a
4 TRCN0000105662 GCATTTCAATATGACTCCAAA pLKO.1 4702 CDS 100% 4.950 3.465 N Arhgap32 n/a
5 TRCN0000048360 GCCTCCAATATCCAGAGACTA pLKO.1 1460 CDS 100% 4.950 3.465 N ARHGAP32 n/a
6 TRCN0000048359 CCAGTTAGATTATGGGTCCAA pLKO.1 5932 CDS 100% 2.640 1.848 N ARHGAP32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018596.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14024 pDONR223 100% 15% 14.1% None (many diffs) n/a
2 ccsbBroad304_14024 pLX_304 0% 15% 14.1% V5 (many diffs) n/a
3 TRCN0000471179 GACGGCAGCCTAGACAAAGCGAGT pLX_317 45.3% 15% 14.1% V5 (many diffs) n/a
Download CSV