Construct: ORF TRCN0000471220
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017612.1_s317c1
- Derived from:
- ccsbBroadEn_12201
- DNA Barcode:
- GTATCGCTATATGTAGCGCCTGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UEVLD (55293)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471220
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55293 | UEVLD | UEV and lactate/malate dehy... | NM_001261383.3 | 100% | 100% | |
| 2 | human | 55293 | UEVLD | UEV and lactate/malate dehy... | NM_018314.6 | 94.1% | 94.1% | 127_192del |
| 3 | human | 55293 | UEVLD | UEV and lactate/malate dehy... | NM_001261385.2 | 90.5% | 90.1% | (many diffs) |
| 4 | human | 55293 | UEVLD | UEV and lactate/malate dehy... | NM_001261382.3 | 79.2% | 78.6% | (many diffs) |
| 5 | human | 55293 | UEVLD | UEV and lactate/malate dehy... | NM_001040697.4 | 75.5% | 74.9% | (many diffs) |
| 6 | human | 55293 | UEVLD | UEV and lactate/malate dehy... | NM_001261384.3 | 55.1% | 54.5% | (many diffs) |
| 7 | human | 55293 | UEVLD | UEV and lactate/malate dehy... | NM_001261386.3 | 54.4% | 50.2% | (many diffs) |
| 8 | human | 55293 | UEVLD | UEV and lactate/malate dehy... | NM_001297771.3 | 50.3% | 47.1% | (many diffs) |
| 9 | mouse | 54122 | Uevld | UEV and lactate/malate dehy... | XM_006540994.3 | 79.6% | 78.3% | (many diffs) |
| 10 | mouse | 54122 | Uevld | UEV and lactate/malate dehy... | XM_006540993.3 | 75.6% | 74.4% | (many diffs) |
| 11 | mouse | 54122 | Uevld | UEV and lactate/malate dehy... | XR_391351.3 | 65.4% | (many diffs) | |
| 12 | mouse | 54122 | Uevld | UEV and lactate/malate dehy... | NM_001040695.1 | 64.6% | 63% | (many diffs) |
| 13 | mouse | 54122 | Uevld | UEV and lactate/malate dehy... | XR_391352.3 | 64.5% | (many diffs) | |
| 14 | mouse | 54122 | Uevld | UEV and lactate/malate dehy... | XR_001785588.1 | 20.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1137
- ORF length:
- 1071
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gttcgactgc gagggcctga gacggctgct tggcaagtac aagttcaggg 121 acctaactgt ggaagaacta aggaatgtaa atgtattttt cccacatttc aaatattcca 181 tggacaccta tggtaataca tataacatac caattcgttt ctggattttg gattctcacc 241 ctttcgctcc ccctatttgc ttcttgaagc caactgcaaa tatgggaatc ttagtcggaa 301 aacatgtgga tgctcaaggc agaatatatt tgccctatct ccaaaactgg agccatccta 361 aatctgtcat tgttggatta attaaagaaa tgattgccaa gtttcaagag gaacttccca 421 tgtattctct atcatcatct gatgaggcac ggcaggtaga cttgctagcc tatattgcaa 481 aaatcactga aggtgtttca gatacaaatt caaagagctg ggcaaatcat gagaataaaa 541 cagtcaataa aattactgtg gttggaggtg gagaactcgg tattgcctgc acattagcaa 601 tttcagcaaa gggtattgca gacaggcttg tcctcttaga cctctcagaa gggactaaag 661 gagccacgat ggaccttgaa atcttcaacc ttccTAATGT GGAGATCAGC AAAGATTTGT 721 CTGCCTCTGC TCATTCCAAG GTGGTGATCT TCACAGTCAA CTCTTTGGGT AGTTCTCAGT 781 CGTACCTTGA TGTGGTACAG AGCAATGTGG ATATGTTCAG AGCCCTTGTC CCAGCTCTGG 841 GACATTATAG TCAACACAGT GTCCTGCTCG TTGCATCTCA ACCAGTGGAA ATCATGACCT 901 ATGTAACATG GAAACTGAGT ACATTTCCTG CAAATCGAGT GATCGGAATT GGATGTAATC 961 TGGATTCACA GAGATTACAG TATATTATTA CAAATGTTTT GAAGGCACAG ACTTCAGGCA 1021 AAGAAGTATG GGTTATTGGC GAGCAAGGAG AAGACAAAGT GCTCACATGG AGTGGCCAAG 1081 AAGAAGTAGT GAGTCATACC TCTCAAGTGC AGCTGTCCAA CAGGGATATT ATGATATACC 1141 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1201 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1261 ATATATCTTG TGGAAAGGAC GAGTATCGCT ATATGTAGCG CCTGCCACGC GTTAAGTCga 1321 caatcaacct ctggattaca aaatttgtga aagatt