Transcript: Human NM_001261384.3

Homo sapiens UEV and lactate/malate dehyrogenase domains (UEVLD), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
UEVLD (55293)
Length:
3958
CDS:
222..1247

Additional Resources:

NCBI RefSeq record:
NM_001261384.3
NBCI Gene record:
UEVLD (55293)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001261384.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314858 ATTCATACTTCGGGAATATTT pLKO_005 1552 3UTR 100% 15.000 21.000 N UEVLD n/a
2 TRCN0000007719 GCAAATCGAGTGATCGGAATT pLKO.1 762 CDS 100% 0.000 0.000 N UEVLD n/a
3 TRCN0000350467 GCAAATCGAGTGATCGGAATT pLKO_005 762 CDS 100% 0.000 0.000 N UEVLD n/a
4 TRCN0000007720 GCTGGGCAAATCATGAGAATA pLKO.1 349 CDS 100% 13.200 9.240 N UEVLD n/a
5 TRCN0000007717 GCTTGGTTAAAGTAGAGGGTT pLKO.1 1360 3UTR 100% 2.640 1.848 N UEVLD n/a
6 TRCN0000007718 GCCAAGTTTCAAGAGGAACTT pLKO.1 228 CDS 100% 0.495 0.347 N UEVLD n/a
7 TRCN0000314857 GCCAAGTTTCAAGAGGAACTT pLKO_005 228 CDS 100% 0.495 0.347 N UEVLD n/a
8 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2638 3UTR 100% 4.950 2.475 Y ORAI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001261384.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12201 pDONR223 100% 55.1% 54.5% None (many diffs) n/a
2 ccsbBroad304_12201 pLX_304 0% 55.1% 54.5% V5 (many diffs) n/a
3 TRCN0000471220 GTATCGCTATATGTAGCGCCTGCC pLX_317 41.5% 55.1% 54.5% V5 (many diffs) n/a
4 ccsbBroadEn_12200 pDONR223 100% 19% 16.9% None (many diffs) n/a
5 ccsbBroad304_12200 pLX_304 0% 19% 16.9% V5 (many diffs) n/a
6 TRCN0000473815 CGAACTAACCGGTGGTTCGGGGGA pLX_317 77.3% 19% 16.9% V5 (many diffs) n/a
Download CSV