Transcript: Mouse XR_001785588.1

PREDICTED: Mus musculus UEV and lactate/malate dehyrogenase domains (Uevld), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Uevld (54122)
Length:
4263
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785588.1
NBCI Gene record:
Uevld (54122)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041176 CCGTCGTCCAATGAAGCGCAA pLKO.1 523 3UTR 100% 0.720 1.008 N Uevld n/a
2 TRCN0000041177 GAAGAATGTGAGCGTGTCTTT pLKO.1 165 3UTR 100% 4.950 3.960 N Uevld n/a
3 TRCN0000041173 GCCAACTGCAAACATGGAAAT pLKO.1 360 3UTR 100% 10.800 7.560 N Uevld n/a
4 TRCN0000041174 GCTGAATTTCACCGGTACAAT pLKO.1 246 3UTR 100% 5.625 3.938 N Uevld n/a
5 TRCN0000007718 GCCAAGTTTCAAGAGGAACTT pLKO.1 487 3UTR 100% 0.495 0.347 N UEVLD n/a
6 TRCN0000314857 GCCAAGTTTCAAGAGGAACTT pLKO_005 487 3UTR 100% 0.495 0.347 N UEVLD n/a
7 TRCN0000011100 CCTGTGATGTATCAGGGTAAT pLKO.1 268 3UTR 100% 10.800 15.120 N UEVLD n/a
8 TRCN0000314856 CCTGTGATGTATCAGGGTAAT pLKO_005 268 3UTR 100% 10.800 15.120 N UEVLD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12201 pDONR223 100% 20.7% None (many diffs) n/a
2 ccsbBroad304_12201 pLX_304 0% 20.7% V5 (many diffs) n/a
3 TRCN0000471220 GTATCGCTATATGTAGCGCCTGCC pLX_317 41.5% 20.7% V5 (many diffs) n/a
4 ccsbBroadEn_12200 pDONR223 100% 10.7% None (many diffs) n/a
5 ccsbBroad304_12200 pLX_304 0% 10.7% V5 (many diffs) n/a
6 TRCN0000473815 CGAACTAACCGGTGGTTCGGGGGA pLX_317 77.3% 10.7% V5 (many diffs) n/a
Download CSV