Construct: ORF TRCN0000471222
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001308.1_s317c1
- Derived from:
- ccsbBroadEn_08513
- DNA Barcode:
- ACCCCTATCGTAGTAACTTTTAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMEM144 (55314)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471222
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55314 | TMEM144 | transmembrane protein 144 | NM_018342.5 | 99.8% | 100% | 39C>T;906A>G |
| 2 | human | 55314 | TMEM144 | transmembrane protein 144 | XM_005263110.2 | 99.8% | 100% | 39C>T;906A>G |
| 3 | human | 55314 | TMEM144 | transmembrane protein 144 | XM_005263112.3 | 99.8% | 100% | 39C>T;906A>G |
| 4 | human | 55314 | TMEM144 | transmembrane protein 144 | XM_006714254.1 | 99.8% | 100% | 39C>T;906A>G |
| 5 | human | 55314 | TMEM144 | transmembrane protein 144 | XM_017008366.1 | 99.8% | 100% | 39C>T;906A>G |
| 6 | human | 55314 | TMEM144 | transmembrane protein 144 | XM_024454128.1 | 99.8% | 100% | 39C>T;906A>G |
| 7 | human | 55314 | TMEM144 | transmembrane protein 144 | XM_017008367.1 | 54.9% | 55% | 0_1ins465;441A>G |
| 8 | human | 55314 | TMEM144 | transmembrane protein 144 | XM_017008368.1 | 54.9% | 55% | 0_1ins465;441A>G |
| 9 | mouse | 70652 | Tmem144 | transmembrane protein 144 | NM_027495.4 | 82% | 85.9% | (many diffs) |
| 10 | mouse | 70652 | Tmem144 | transmembrane protein 144 | XM_006502057.3 | 82% | 85.9% | (many diffs) |
| 11 | mouse | 70652 | Tmem144 | transmembrane protein 144 | XM_006502058.3 | 82% | 85.9% | (many diffs) |
| 12 | mouse | 70652 | Tmem144 | transmembrane protein 144 | XM_006502059.3 | 82% | 85.9% | (many diffs) |
| 13 | mouse | 70652 | Tmem144 | transmembrane protein 144 | XM_011240224.2 | 82% | 85.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1101
- ORF length:
- 1035
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag caacaatgga gcagacctaa cctttggtta catttcctgt tttgtagcta 121 tccttttgtt tggctcaaat tttgtgccac ttaaaaaatt tgatactggt gatggaatgt 181 ttctccagtg ggttctttgt gctgccatat ggttggttgc cttggttgtc aatctgatat 241 tacattgtcc aaagttttgg ccttttgcaa tgcttggggg ctgcatttgg gcaacaggga 301 acattgctgt tgtcccaatt atcaaaacca ttggtttagg ccttggaatc ttaatctggg 361 gatcatttaa tgccttaact ggctgggcaa gctcaaggtt tggctggttt ggattggatg 421 cagaagaagt atcaaatccg ctgctaaatt acattggagc tgggctatca gtagtaagtg 481 ctttcatatt tttgttcatc aaaagtgaaa taccaaataa cacgtgttcc atggatacca 541 ctccattaat aacagagcat gtgatcaaca caacccaaga cccctgttcc tgggtggata 601 aactttcTAC AGTACACCAC CGCATAGTGG GCTGCAGTCT TGCAGTGATA TCTGGAGTAC 661 TCTATGGATC TACATTTGTG CCAATCATCT ACATCAAGGA CCACAGCAAA AGAAATGATA 721 GTATATATGC AGGGGCAAGC CAATATGATT TAGACTATGT GTTTGCGCAC TTCAGTGGCA 781 TCTTTCTTAC AAGTACTGTC TACTTTCTGG CCTACTGCAT AGCCATGAAA AATAGTCCTA 841 AACTATATCC TGAAGCAGTC CTACCAGGAT TCCTGTCAGG AGTACTTTGG GCTATAGCTA 901 CCTGCTGTTG GTTCATAGCA AATCACTCTC TGAGTGCTGT GGTCAGTTTT CCAATAATCA 961 CTGCTGGTCC GGGATTTATA GCTGCAATGT GGGGTATCTT CATGTTTAAG GAAATAAAGG 1021 GTCTACAAAA CTACCTATTA ATGATACTTG CATTTTGCAT CATCTTGACT GGAGCCTTAT 1081 GCACTGCTTT TTCTAAAATC TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1141 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1201 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAACCC CTATCGTAGT 1261 AACTTTTAGC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt