Transcript: Human XM_006714254.1

PREDICTED: Homo sapiens transmembrane protein 144 (TMEM144), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM144 (55314)
Length:
3130
CDS:
333..1370

Additional Resources:

NCBI RefSeq record:
XM_006714254.1
NBCI Gene record:
TMEM144 (55314)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431236 GTTTAGGCCTTGGAATCTTAA pLKO_005 601 CDS 100% 13.200 18.480 N TMEM144 n/a
2 TRCN0000148240 GAGTACTCTATGGATCTACAT pLKO.1 922 CDS 100% 4.950 6.930 N TMEM144 n/a
3 TRCN0000147726 GCTATCAGTAGTAAGTGCTTT pLKO.1 731 CDS 100% 4.950 6.930 N TMEM144 n/a
4 TRCN0000131206 GCTGGGCTATCAGTAGTAAGT pLKO.1 726 CDS 100% 4.950 6.930 N TMEM144 n/a
5 TRCN0000149372 GCCAATCATCTACATCAAGGA pLKO.1 947 CDS 100% 2.640 3.696 N TMEM144 n/a
6 TRCN0000413754 GTCCATATTTCTCACCTATTA pLKO_005 1729 3UTR 100% 13.200 10.560 N TMEM144 n/a
7 TRCN0000435392 GTTTATGAAGGTAGTACTTTA pLKO_005 1584 3UTR 100% 13.200 9.240 N TMEM144 n/a
8 TRCN0000146424 CCACAGTATGTACCTAGTGTT pLKO.1 1662 3UTR 100% 4.950 3.465 N TMEM144 n/a
9 TRCN0000130832 GCCTTGGTTGTCAATCTGATA pLKO.1 486 CDS 100% 4.950 3.465 N TMEM144 n/a
10 TRCN0000418717 CACTGTTGGAGTGGGTAAATG pLKO_005 1482 3UTR 100% 13.200 7.920 N TMEM144 n/a
11 TRCN0000130991 CATCATCTTGACTGGAGCCTT pLKO.1 1325 CDS 100% 2.640 1.584 N TMEM144 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03577 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03577 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481474 CGTTTGATATCTAATTATGCCGGT pLX_317 43.6% 100% 100% V5 n/a
4 ccsbBroadEn_08513 pDONR223 100% 99.8% 100% None 39C>T;906A>G n/a
5 ccsbBroad304_08513 pLX_304 0% 99.8% 100% V5 39C>T;906A>G n/a
6 TRCN0000471222 ACCCCTATCGTAGTAACTTTTAGC pLX_317 47.7% 99.8% 100% V5 39C>T;906A>G n/a
Download CSV