Transcript: Mouse XM_006502059.3

PREDICTED: Mus musculus transmembrane protein 144 (Tmem144), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem144 (70652)
Length:
2736
CDS:
191..1237

Additional Resources:

NCBI RefSeq record:
XM_006502059.3
NBCI Gene record:
Tmem144 (70652)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502059.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366467 ATACTCTACGGATCGACATTT pLKO_005 791 CDS 100% 13.200 18.480 N Tmem144 n/a
2 TRCN0000379206 TTTGGGCAACAGGCAACATTG pLKO_005 411 CDS 100% 10.800 15.120 N Tmem144 n/a
3 TRCN0000181942 CATCGGTTTAGGACTTGGAAT pLKO.1 454 CDS 100% 4.950 6.930 N Tmem144 n/a
4 TRCN0000181395 CCTTGCGGTAATATCTGGAAT pLKO.1 772 CDS 100% 4.950 6.930 N Tmem144 n/a
5 TRCN0000200065 CCATCGGTTTAGGACTTGGAA pLKO.1 453 CDS 100% 3.000 4.200 N Tmem144 n/a
6 TRCN0000216605 GAAATTACCATCCCAATTTAT pLKO.1 1570 3UTR 100% 1.500 2.100 N Tmem144 n/a
7 TRCN0000366466 GATACTGCACTGCCCTAAATT pLKO_005 361 CDS 100% 15.000 12.000 N Tmem144 n/a
8 TRCN0000366465 TCTGGGAATGAACGGATAAAT pLKO_005 1356 3UTR 100% 15.000 12.000 N Tmem144 n/a
9 TRCN0000366464 AGGCGCTAGCCAGTATGATTT pLKO_005 865 CDS 100% 13.200 9.240 N Tmem144 n/a
10 TRCN0000375189 CATCGCCAACCACTCACTAAG pLKO_005 1048 CDS 100% 10.800 7.560 N Tmem144 n/a
11 TRCN0000375256 GGATCATCCTGTCTAACAATG pLKO_005 1502 3UTR 100% 10.800 7.560 N Tmem144 n/a
12 TRCN0000366397 GGGATCATTTAACACCTTAAC pLKO_005 484 CDS 100% 10.800 7.560 N Tmem144 n/a
13 TRCN0000198809 CGGATCATCCTGTCTAACAAT pLKO.1 1501 3UTR 100% 5.625 3.938 N Tmem144 n/a
14 TRCN0000198848 CTCGCTTTCTGCATCATCTTA pLKO.1 1181 CDS 100% 5.625 3.938 N Tmem144 n/a
15 TRCN0000181844 GCTCCAACTTTGTACCACTTA pLKO.1 258 CDS 100% 4.950 3.465 N Tmem144 n/a
16 TRCN0000182580 GCCTTGCGGTAATATCTGGAA pLKO.1 771 CDS 100% 2.640 1.848 N Tmem144 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502059.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03577 pDONR223 100% 82.1% 85.9% None (many diffs) n/a
2 ccsbBroad304_03577 pLX_304 0% 82.1% 85.9% V5 (many diffs) n/a
3 TRCN0000481474 CGTTTGATATCTAATTATGCCGGT pLX_317 43.6% 82.1% 85.9% V5 (many diffs) n/a
4 ccsbBroadEn_08513 pDONR223 100% 82% 85.9% None (many diffs) n/a
5 ccsbBroad304_08513 pLX_304 0% 82% 85.9% V5 (many diffs) n/a
6 TRCN0000471222 ACCCCTATCGTAGTAACTTTTAGC pLX_317 47.7% 82% 85.9% V5 (many diffs) n/a
Download CSV