Construct: ORF TRCN0000471232
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017392.1_s317c1
- Derived from:
- ccsbBroadEn_01853
- DNA Barcode:
- TAGAAGACATCCAAGCTTTATAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TUSC3 (7991)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471232
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7991 | TUSC3 | tumor suppressor candidate 3 | NM_178234.2 | 100% | 100% | |
| 2 | human | 7991 | TUSC3 | tumor suppressor candidate 3 | NM_001356429.2 | 98.5% | 98.8% | (many diffs) |
| 3 | human | 7991 | TUSC3 | tumor suppressor candidate 3 | NM_006765.4 | 98.5% | 98.8% | (many diffs) |
| 4 | human | 7991 | TUSC3 | tumor suppressor candidate 3 | XM_017013861.2 | 82.5% | 82.7% | (many diffs) |
| 5 | human | 7991 | TUSC3 | tumor suppressor candidate 3 | XM_011544651.3 | 80.5% | 79.6% | (many diffs) |
| 6 | mouse | 80286 | Tusc3 | tumor suppressor candidate 3 | NM_030254.3 | 90.7% | 98.5% | (many diffs) |
| 7 | mouse | 80286 | Tusc3 | tumor suppressor candidate 3 | XM_017313023.1 | 89.5% | 97.7% | (many diffs) |
| 8 | mouse | 80286 | Tusc3 | tumor suppressor candidate 3 | XM_017313025.1 | 82.3% | 89.9% | (many diffs) |
| 9 | mouse | 80286 | Tusc3 | tumor suppressor candidate 3 | XM_017313024.1 | 81.1% | 89% | (many diffs) |
| 10 | mouse | 80286 | Tusc3 | tumor suppressor candidate 3 | XM_017313027.1 | 78.5% | 85% | (many diffs) |
| 11 | mouse | 80286 | Tusc3 | tumor suppressor candidate 3 | XM_017313026.1 | 77.3% | 84.1% | (many diffs) |
| 12 | mouse | 80286 | Tusc3 | tumor suppressor candidate 3 | XM_017313030.1 | 76.5% | 82.9% | (many diffs) |
| 13 | mouse | 80286 | Tusc3 | tumor suppressor candidate 3 | XM_017313028.1 | 75.3% | 82.1% | (many diffs) |
| 14 | mouse | 80286 | Tusc3 | tumor suppressor candidate 3 | XM_017313029.1 | 75.3% | 82.1% | (many diffs) |
| 15 | mouse | 80286 | Tusc3 | tumor suppressor candidate 3 | XR_001778489.1 | 36.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1107
- ORF length:
- 1041
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg ggcccggggc gctccttcac gccgtaggca agcggggcgg cggctgcggt 121 acctgcccac cgggagcttt cccttccttc tcctgctgct gctgctctgc atccagctcg 181 ggggaggaca gaagaaaaag gagaatcttt tagctgaaaa agtagagcag ctgatggaat 241 ggagttccag acgctcaatc ttccgaatga atggtgataa attccgaaaa tttataaagg 301 caccacctcg aaactattcc atgattgtta tgttcactgc tcttcagcct cagcggcagt 361 gttctgtgtg caggcaagct aatgaagaat atcaaatact ggcgaactcc tggcgctatt 421 catctgcttt ttgtaacaag ctcttcttca gtatggtgga ctatgatgag gggacagacg 481 tttttcagca gctcaacatg aactctgctc ctacattcat gcattttcct ccaaaaggca 541 gacctaagag agctgatact tttgacctcc aaagaattgg atttgcagct gagcaactag 601 caaagtggat tgctgacaga acggatgttc atattcgggt tttcagacca cccaactact 661 ctggtaccat tgctttggcc ctgttagtgt cgcttgttgg aggtttgctt tatttgagaa 721 ggaacaactt ggagttcatc tataacaaga ctggttgggc catggtgtct ctgtgtatag 781 tctttgctat gacttctggc cagatgtgga accatatccg tggacctcca tatgctcata 841 agaacccaca caatggacaa gtgagctaca ttcatgggag cagccaggct cagtttgtgg 901 cagaatcaca CATTATTCTG GTACTGAATG CCGCTATCAC CATGGGGATG GTTCTTCTAA 961 ATGAAGCAGC AACTTCGAAA GGCGATGTTG GAAAAAGACG GATAATTTGC CTAGTGGGAT 1021 TGGGCCTGGT GGTCTTCTTC TTCAGTTTTC TACTTTCAAT ATTTCGTTCC AAGTACCACG 1081 GCTATCCTTA TAGCTTTTTA ATTAAATGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1141 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1201 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATAGAAGAC 1261 ATCCAAGCTT TATAAAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1321 aagatt