Transcript: Human XM_017013861.2

PREDICTED: Homo sapiens tumor suppressor candidate 3 (TUSC3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TUSC3 (7991)
Length:
6062
CDS:
20..898

Additional Resources:

NCBI RefSeq record:
XM_017013861.2
NBCI Gene record:
TUSC3 (7991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038065 CCTCGAAACTATTCCATGATT pLKO.1 92 CDS 100% 5.625 7.875 N TUSC3 n/a
2 TRCN0000299107 CCTCGAAACTATTCCATGATT pLKO_005 92 CDS 100% 5.625 7.875 N TUSC3 n/a
3 TRCN0000038068 CTGGCGCTATTCATCTGCTTT pLKO.1 196 CDS 100% 4.950 6.930 N TUSC3 n/a
4 TRCN0000299109 CTGGCGCTATTCATCTGCTTT pLKO_005 196 CDS 100% 4.950 6.930 N TUSC3 n/a
5 TRCN0000038064 CGGATGTTCATATTCGGGTTT pLKO.1 408 CDS 100% 4.050 5.670 N TUSC3 n/a
6 TRCN0000299039 CGGATGTTCATATTCGGGTTT pLKO_005 408 CDS 100% 4.050 5.670 N TUSC3 n/a
7 TRCN0000038066 GCTCATAAGAACCCACACAAT pLKO.1 620 CDS 100% 4.950 3.465 N TUSC3 n/a
8 TRCN0000299038 GCTCATAAGAACCCACACAAT pLKO_005 620 CDS 100% 4.950 3.465 N TUSC3 n/a
9 TRCN0000038067 CACATTATTCTGGTACTGAAT pLKO.1 695 CDS 100% 4.950 2.970 N TUSC3 n/a
10 TRCN0000299106 CACATTATTCTGGTACTGAAT pLKO_005 695 CDS 100% 4.950 2.970 N TUSC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01853 pDONR223 100% 82.5% 82.7% None (many diffs) n/a
2 ccsbBroad304_01853 pLX_304 0% 82.5% 82.7% V5 (many diffs) n/a
3 TRCN0000471232 TAGAAGACATCCAAGCTTTATAAA pLX_317 19.5% 82.5% 82.7% V5 (many diffs) n/a
Download CSV