Construct: ORF TRCN0000471256
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000347.1_s317c1
- Derived from:
- ccsbBroadEn_15931
- DNA Barcode:
- GCTACTACTCTTGACTGACGAACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HMCES (56941)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471256
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56941 | HMCES | 5-hydroxymethylcytosine bin... | NM_001006109.1 | 100% | 100% | |
| 2 | human | 56941 | HMCES | 5-hydroxymethylcytosine bin... | NM_001370343.1 | 100% | 100% | |
| 3 | human | 56941 | HMCES | 5-hydroxymethylcytosine bin... | NM_001370344.1 | 100% | 100% | |
| 4 | human | 56941 | HMCES | 5-hydroxymethylcytosine bin... | NM_020187.3 | 100% | 100% | |
| 5 | human | 56941 | HMCES | 5-hydroxymethylcytosine bin... | NM_001363881.1 | 88.1% | 88.1% | 324_325ins126 |
| 6 | human | 56941 | HMCES | 5-hydroxymethylcytosine bin... | NM_001370345.1 | 86.4% | 86.4% | 180_181ins144 |
| 7 | mouse | 232210 | Hmces | 5-hydroxymethylcytosine (hm... | NM_173737.2 | 84.6% | 83.9% | (many diffs) |
| 8 | mouse | 232210 | Hmces | 5-hydroxymethylcytosine (hm... | XR_377441.3 | 58.7% | (many diffs) | |
| 9 | mouse | 232210 | Hmces | 5-hydroxymethylcytosine (hm... | XR_001785121.1 | 48.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1128
- ORF length:
- 1062
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg tgggcgaaca tcctgtcact tacctagaga tgttctcacg agagcttgcg 121 cctaccagga tcggcggggc cagcagcggc tcccggagtg gagggaccct gataagtact 181 gcccctctta caacaagagt cctcaatcca acagcccagt gcttctgtct cgactgcact 241 ttgagaagga tgcagactca tctgagcgta tcattgctcc catgcgctgg ggcttggtcc 301 cttcttggtt caaagaaagt gatccttcca agctgcagtt caatactacc aactgtcgta 361 gtgataccgt aatggagaaa cggtcattta aggtgcctct gggaaaggga agacgctgtg 421 tcgttttagc agatggattc tatgagtggc agcgatgtca gggaacaaac cagaggcagc 481 catacttcat ctattttcct caaatcaaga cagagaagtc aggtagcatt ggtgctgcag 541 atagtcctga gaactgggag aaagtctggg acaactggag gctgctgaca atggccggga 601 tctttgactg ctgggagccc ccagagggag gagatgtcct gtattcctat accatcatca 661 cagtggattc ctgcaaaggc ttgagtgaca tccaccacag gatgcctgcc atattagatg 721 gagaggaggc agtttctaaa tggcttgact ttggtgaagt ctcaactcag gaagctctga 781 aattaatcca cccaacagag aacatcaccT TCCATGCAGT CTCTTCTGTG GTGAACAACT 841 CGCGAAACAA CACTCCTGAG TGTCTGGCTC CTGTCGACTT GGTGGTCAAA AAGGAGCTCA 901 GGGCAAGTGG CAGTAGCCAG AGGATGTTGC AGTGGTTGGC CACAAAGTCA CCCAAAAAGG 961 AAGACTCAAA AACACCTCAA AAGGAAGAGT CAGATGTTCC CCAGTGGTCC AGTCAGTTCC 1021 TGCAGAAGAG TCCACTCCCC ACCAAGAGAG GCACTGCAGG ACTCCTAGAG CAATGGCTGA 1081 AGCGGGAGAA GGAGGAGGAA CCTGTGGCCA AGCGTCCTTA CAGCCAGTGC CCAACTTTCT 1141 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1201 CGTAGTAATG AACTAGCCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1261 GTGGAAAGGA CGAGCTACTA CTCTTGACTG ACGAACTACG CGTTAAGTCg acaatcaacc 1321 tctggattac aaaatttgtg aaagatt