Transcript: Mouse XR_001785121.1

PREDICTED: Mus musculus 5-hydroxymethylcytosine (hmC) binding, ES cell specific (Hmces), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Hmces (232210)
Length:
1865
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785121.1
NBCI Gene record:
Hmces (232210)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149845 CTACCAACTGTCGTAGTGATA pLKO.1 408 3UTR 100% 4.950 3.960 N HMCES n/a
2 TRCN0000193844 CGGATAATTATTCCCATGCGA pLKO.1 329 3UTR 100% 0.750 0.600 N Hmces n/a
3 TRCN0000285665 CAATGTCAGCTGACCTGAAAG pLKO_005 1661 3UTR 100% 10.800 7.560 N Hmces n/a
4 TRCN0000285664 TATCACCTTCCATCCAGTTTC pLKO_005 1245 3UTR 100% 10.800 7.560 N Hmces n/a
5 TRCN0000276800 TGACAATGGCAGGGATCTTTG pLKO_005 648 3UTR 100% 10.800 7.560 N Hmces n/a
6 TRCN0000175276 CATAATGGAGAAGCAGTCATT pLKO.1 430 3UTR 100% 4.950 3.465 N Hmces n/a
7 TRCN0000173740 CCAGAGGCAACCATACTTCAT pLKO.1 532 3UTR 100% 4.950 3.465 N Hmces n/a
8 TRCN0000276801 CCAGAGGCAACCATACTTCAT pLKO_005 532 3UTR 100% 4.950 3.465 N Hmces n/a
9 TRCN0000176276 CCTGTATTCCTACAGCATCAT pLKO.1 697 3UTR 100% 0.495 0.347 N Hmces n/a
10 TRCN0000276755 CCTGTATTCCTACAGCATCAT pLKO_005 697 3UTR 100% 0.495 0.347 N Hmces n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15931 pDONR223 0% 48.5% None (many diffs) n/a
2 ccsbBroad304_15931 pLX_304 0% 48.5% V5 (many diffs) n/a
3 TRCN0000471256 GCTACTACTCTTGACTGACGAACT pLX_317 30.4% 48.5% V5 (many diffs) n/a
Download CSV