Construct: ORF TRCN0000471257
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015378.1_s317c1
- Derived from:
- ccsbBroadEn_10229
- DNA Barcode:
- ATGGTCCTTTGTTTTTTGCTAACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TNFSF12 (8742)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471257
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8742 | TNFSF12 | TNF superfamily member 12 | NM_003809.3 | 52.3% | 50.6% | (many diffs) |
2 | human | 407977 | TNFSF12-TNFSF13 | TNFSF12-TNFSF13 readthrough | NM_172089.4 | 39.4% | 38.1% | (many diffs) |
3 | human | 8742 | TNFSF12 | TNF superfamily member 12 | NR_037146.2 | 24.8% | 1_96del;499_1616del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 468
- ORF length:
- 402
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cgcccgtcgg agccagaggc ggagggggcg ccggggggag ccgggcaccg 121 ccctgctggt cccgctcgcg ctgggcctgg gcctggcgct ggcctgcctc ggcctcctgc 181 tggccgtggt cagtttgggg agccgggcat cgctgtccgc ccaggagcct gcccaggagg 241 agctggtggc agaggaggac caggacccgt cggaactgaa tccccagaca gaagaaagcc 301 aggatcctgc gcctttcctg aaccgacTAG TTCGGCCTCG CAGAAGTGCA CCTAAAGGCC 361 GGAAAACACG GGCTCGAAGA GCGATCGCAG CCCATTATGA AGTTCATCCA CGACCTGGAC 421 AGGACGGAGC GCAGGCAGAT GGAGGTTACA CAACTTGTCT GAGGCCATGC CCAACTTTCT 481 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 541 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 601 GTGGAAAGGA CGAATGGTCC TTTGTTTTTT GCTAACAACG CGTTAAGTCg acaatcaacc 661 tctggattac aaaatttgtg aaagatt