Transcript: Human NM_172089.4

Homo sapiens TNFSF12-TNFSF13 readthrough (TNFSF12-TNFSF13), mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TNFSF12-TNFSF13 (407977)
Length:
1857
CDS:
97..1089

Additional Resources:

NCBI RefSeq record:
NM_172089.4
NBCI Gene record:
TNFSF12-TNFSF13 (407977)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172089.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204769 GACAGCCAAGAGCTGAGTATA pLKO.1 1145 3UTR 100% 13.200 6.600 Y TNFSF12-TNFSF13 n/a
2 TRCN0000059023 GAGACTCTATTCCGATGTATA pLKO.1 907 CDS 100% 13.200 6.600 Y TNFSF13 n/a
3 TRCN0000059026 CGCAGGTGTCTTCCATTTACA pLKO.1 975 CDS 100% 5.625 2.813 Y TNFSF13 n/a
4 TRCN0000204329 CGCAGGTGTCTTCCATTTACA pLKO.1 975 CDS 100% 5.625 2.813 Y TNFSF12-TNFSF13 n/a
5 TRCN0000059025 CCTGTTTCAAGACGTGACTTT pLKO.1 843 CDS 100% 4.950 2.475 Y TNFSF13 n/a
6 TRCN0000186304 CTTCGCAGTCAAATTACTCTT pLKO.1 1642 3UTR 100% 4.950 2.475 Y TNFSF12-TNFSF13 n/a
7 TRCN0000058149 GCAGCCCATTATGAAGTTCAT pLKO.1 418 CDS 100% 4.950 2.475 Y TNFSF12 n/a
8 TRCN0000204191 GCAGCCCATTATGAAGTTCAT pLKO.1 418 CDS 100% 4.950 2.475 Y TNFSF12-TNFSF13 n/a
9 TRCN0000188573 CCAAGGATATGGTGTCCGAAT pLKO.1 786 CDS 100% 4.050 2.025 Y TNFSF12-TNFSF13 n/a
10 TRCN0000204239 CAAGGGCGAAACTTAACCTCT pLKO.1 1031 CDS 100% 2.640 1.320 Y TNFSF12-TNFSF13 n/a
11 TRCN0000058151 CAGACAGAAGAAAGCCAGGAT pLKO.1 316 CDS 100% 2.640 1.320 Y TNFSF12 n/a
12 TRCN0000059027 GCGAAACTTAACCTCTCTCCA pLKO.1 1036 CDS 100% 2.640 1.320 Y TNFSF13 n/a
13 TRCN0000059024 GAATCCAGGATGCTGGAGTTT pLKO.1 803 CDS 100% 0.495 0.248 Y TNFSF13 n/a
14 TRCN0000058150 CCTTTCCTGAACCGACTAGTT pLKO.1 343 CDS 100% 0.000 0.000 Y TNFSF12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172089.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07293 pDONR223 99.4% 67.4% 55.1% None (many diffs) n/a
2 ccsbBroad304_07293 pLX_304 0% 67.4% 55.1% V5 (many diffs) n/a
3 TRCN0000475473 TACGTGCAGATCGTGCACATACGC pLX_317 29.7% 67.4% 55.1% V5 (many diffs) n/a
4 ccsbBroadEn_07292 pDONR223 100% 65.7% 55.9% None (many diffs) n/a
5 ccsbBroad304_07292 pLX_304 0% 65.7% 55.9% V5 (many diffs) n/a
6 TRCN0000491921 CGAGAAGCCCCTTATGACGTCTTC pLX_317 47.5% 65.7% 55.9% V5 (many diffs) n/a
7 ccsbBroadEn_10229 pDONR223 100% 39.4% 38.1% None (many diffs) n/a
8 ccsbBroad304_10229 pLX_304 0% 39.4% 38.1% V5 (many diffs) n/a
9 TRCN0000471257 ATGGTCCTTTGTTTTTTGCTAACA pLX_317 35.7% 39.4% 38.1% V5 (many diffs) n/a
Download CSV