Construct: ORF TRCN0000471373
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010008.1_s317c1
- Derived from:
- ccsbBroadEn_11427
- DNA Barcode:
- TTCTGGATGCTTGTGCCGGAGCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FCHSD2 (9873)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471373
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9873 | FCHSD2 | FCH and double SH3 domains 2 | XM_011545410.2 | 72% | 71.6% | (many diffs) |
| 2 | human | 9873 | FCHSD2 | FCH and double SH3 domains 2 | XM_011545409.1 | 71.6% | 71.2% | (many diffs) |
| 3 | human | 9873 | FCHSD2 | FCH and double SH3 domains 2 | XM_017018632.1 | 71.6% | 71.2% | (many diffs) |
| 4 | human | 9873 | FCHSD2 | FCH and double SH3 domains 2 | NM_014824.3 | 69.5% | 69.1% | (many diffs) |
| 5 | human | 9873 | FCHSD2 | FCH and double SH3 domains 2 | XR_001748055.1 | 31.7% | (many diffs) | |
| 6 | mouse | 207278 | Fchsd2 | FCH and double SH3 domains 2 | NM_001146010.1 | 64.5% | 67.4% | (many diffs) |
| 7 | mouse | 207278 | Fchsd2 | FCH and double SH3 domains 2 | XM_006507517.3 | 63.9% | 67.2% | (many diffs) |
| 8 | mouse | 207278 | Fchsd2 | FCH and double SH3 domains 2 | NM_199012.2 | 62.5% | 65.3% | (many diffs) |
| 9 | mouse | 207278 | Fchsd2 | FCH and double SH3 domains 2 | XM_006507518.2 | 53.6% | 56.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1611
- ORF length:
- 1545
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca gaagttggct agtcaatacc tgaagagaga ttggcctgga gtaaaagctg 121 atgatcggaa tgattacagg agcatgtatc ccgtttggaa atcttttctc gagggaacaa 181 tgcaggtagc ccagtctcgg atgaatatat gtgaaaacta taaaaacttc atttctgagc 241 ctgcaaggac agtgagaagc ttaaaagaac agcaactaaa aaggtgtgtg gaccagttga 301 caaagatcca aactgaatta caagagacag tgaaagattt agctaaaggc aaaaagaaat 361 actttgagac tgaacagatg gctcatgcag tacgagagaa agctgacatc gaggcaaaat 421 ctaaacttag tctttttcaa tcaagaatca gtttacagaa ggcaagtgta aagttaaaag 481 cccggcgatc tgagtgtaat tccaaagcta cccacgcaag gaatgattat cttcttaccc 541 tagcggcagc aaatgcacat caggatcgct actatcaaac agatttagtt aacattatga 601 aggctcttga tggaaatgtg tatgatcatc tcaaggatta tttaatagcc ttcagccgga 661 ctgagctaga aacatgccaa gctgtgcaga acacattcca gtttttatta gaaaactcca 721 gcaaggtggt ccgggactac aatcttcagc tgtttttgca agaaaacgct gtatttcaca 781 aaccccagcc cttccagttc cagccttgtg acagtgatac tagccgacag ttagaatcag 841 aaactgggac cacagaggag cacagtctaa ataaggaagc tcgaaaatgg gccacacgtg 901 tggcacgtga gcataaaaac attgttcacc aacaacgggt tctaaatgat ctggagtgtc 961 atggagctgc tgtatcagaa caaagccgag cagagctaga acagaaaata gatgaagcta 1021 gagaaaatat tcgtaaagca gagataatta aattgaaagc tgaagcccgg ttggacctgc 1081 taaagcagat tggtgtttct gtggacacat ggctaaagag tgccatgaac caagtaatgg 1141 aagaactgga aaatgagcga tgggcccgcc ctccTGCAGT GACCAGTAAT GGCACTTTAC 1201 ACTCGCTTAA TGCAGATACC GAAAGAGAAG AAGGCGAAGA GTTTGAAGAT AACATGGATG 1261 TTTTCGATGA CAGCAGTTCC AGCCCTTCTG GCACCTTAAG AAATTATCCA CTCACCTGCA 1321 AAGTTGTTTA TTCCTACAAG GCTTCTCAAC CAGATGAGTT GACCATTGAG GAACATGAGG 1381 TGTTAGAAGT GATTGAAGAT GGAGATATGG AAGACTGGGT AAAGGCTCGA AATAAAGTTG 1441 GCCAAGTGGG TTATGTGCCA GAAAAGTACC TACAGTTTCC CACCTCGAAC AGCCTCCTGA 1501 GCATGCTGCA GTCCCTGGCC GCTTTGGACA GTCGGTCACA CACGTCCAGC AATTCCACGG 1561 AAGCAGAACT CGTTTCAGGC AGCCTCAACG GAGATGCCAG TGGTAAAGAC TGCCCAACTT 1621 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1681 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1741 CTTGTGGAAA GGACGATTCT GGATGCTTGT GCCGGAGCAA ACGCGTTAAG TCgacaatca 1801 acctctggat tacaaaattt gtgaaagatt