Transcript: Human XM_011545410.2

PREDICTED: Homo sapiens FCH and double SH3 domains 2 (FCHSD2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FCHSD2 (9873)
Length:
4307
CDS:
112..2259

Additional Resources:

NCBI RefSeq record:
XM_011545410.2
NBCI Gene record:
FCHSD2 (9873)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147035 CGGATCTGAAATTAGCCAATA pLKO.1 3019 3UTR 100% 10.800 15.120 N FCHSD2 n/a
2 TRCN0000149325 GCCCTGAATTTAGCACCAATT pLKO.1 2815 3UTR 100% 10.800 15.120 N FCHSD2 n/a
3 TRCN0000147537 GAATGATTACAGGAGCATGTA pLKO.1 267 CDS 100% 4.950 6.930 N FCHSD2 n/a
4 TRCN0000130412 GCCGACAGTTAGAATCAGAAA pLKO.1 962 CDS 100% 4.950 6.930 N FCHSD2 n/a
5 TRCN0000148919 CGCTTAATGCAGATACCGAAA pLKO.1 1343 CDS 100% 4.050 5.670 N FCHSD2 n/a
6 TRCN0000146910 CGACAGTTAGAATCAGAAACT pLKO.1 964 CDS 100% 4.950 3.960 N FCHSD2 n/a
7 TRCN0000128620 CCAGTCTTGTATTCTGTCTTT pLKO.1 3983 3UTR 100% 4.950 3.465 N FCHSD2 n/a
8 TRCN0000127594 CGAGCAGAGCTAGAACAGAAA pLKO.1 1126 CDS 100% 4.950 3.465 N FCHSD2 n/a
9 TRCN0000128837 GCCAAACATCAAGCAGAATGT pLKO.1 33 5UTR 100% 4.950 3.465 N FCHSD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11427 pDONR223 100% 72% 71.6% None (many diffs) n/a
2 ccsbBroad304_11427 pLX_304 0% 72% 71.6% V5 (many diffs) n/a
3 TRCN0000471373 TTCTGGATGCTTGTGCCGGAGCAA pLX_317 28.5% 72% 71.6% V5 (many diffs) n/a
Download CSV