Transcript: Mouse NM_199012.2

Mus musculus FCH and double SH3 domains 2 (Fchsd2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fchsd2 (207278)
Length:
4432
CDS:
245..2539

Additional Resources:

NCBI RefSeq record:
NM_199012.2
NBCI Gene record:
Fchsd2 (207278)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197684 CGATCTGAATGTAATACCAAA pLKO.1 833 CDS 100% 4.950 3.960 N Fchsd2 n/a
2 TRCN0000197429 CGCTACTATCAAACAGACTTA pLKO.1 914 CDS 100% 4.950 3.960 N Fchsd2 n/a
3 TRCN0000176953 GCTGATCTTCAAAGTGCTTAT pLKO.1 4038 3UTR 100% 10.800 7.560 N Fchsd2 n/a
4 TRCN0000178492 GCACATCTCTTCCTCAACTAA pLKO.1 3072 3UTR 100% 5.625 3.938 N Fchsd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11427 pDONR223 100% 62.5% 65.3% None (many diffs) n/a
2 ccsbBroad304_11427 pLX_304 0% 62.5% 65.3% V5 (many diffs) n/a
3 TRCN0000471373 TTCTGGATGCTTGTGCCGGAGCAA pLX_317 28.5% 62.5% 65.3% V5 (many diffs) n/a
Download CSV