Construct: ORF TRCN0000471413
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015025.1_s317c1
- Derived from:
- ccsbBroadEn_02560
- DNA Barcode:
- AGGGCACTCGTATTGGCCCGCTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RNPS1 (10921)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471413
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10921 | RNPS1 | RNA binding protein with se... | NM_001286625.1 | 100% | 100% | |
| 2 | human | 10921 | RNPS1 | RNA binding protein with se... | NM_006711.4 | 100% | 100% | |
| 3 | human | 10921 | RNPS1 | RNA binding protein with se... | NM_080594.4 | 100% | 100% | |
| 4 | human | 10921 | RNPS1 | RNA binding protein with se... | XM_005255048.2 | 100% | 100% | |
| 5 | human | 10921 | RNPS1 | RNA binding protein with se... | XM_005255049.4 | 100% | 100% | |
| 6 | human | 10921 | RNPS1 | RNA binding protein with se... | NM_001286626.2 | 92.3% | 92.1% | 0_1ins69;2T>G |
| 7 | human | 10921 | RNPS1 | RNA binding protein with se... | NM_001286627.2 | 71.5% | 65.5% | (many diffs) |
| 8 | human | 10921 | RNPS1 | RNA binding protein with se... | NR_104485.2 | 45.4% | (many diffs) | |
| 9 | mouse | 19826 | Rnps1 | ribonucleic acid binding pr... | NM_001080127.1 | 89.2% | 100% | (many diffs) |
| 10 | mouse | 19826 | Rnps1 | ribonucleic acid binding pr... | NM_009070.2 | 89.2% | 100% | (many diffs) |
| 11 | mouse | 19826 | Rnps1 | ribonucleic acid binding pr... | XM_017317362.1 | 89.2% | 100% | (many diffs) |
| 12 | mouse | 19826 | Rnps1 | ribonucleic acid binding pr... | NM_001080128.1 | 81.7% | 92.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 981
- ORF length:
- 915
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tttatcagga gtgaaaaaga agagcttgct aggagtcaaa gaaaataata 121 aaaagtccag cactagggct ccttcaccta ccaaacgcaa agaccgctca gatgagaagt 181 ccaaggatcg ctcaaaagat aaaggggcca ccaaggagtc gagtgagaag gatcgcggcc 241 gggacaaaac ccgaaagagg cgcagcgctt ccagtggtag cagcagtacc aggtctcggt 301 ccagctcgac ttccagctca ggctccagca ccagcactgg ctcaagcagt ggctccagct 361 cttcctcagc atccagccgc tcaggaagct ccagcacctc ccgcagctcc agctctagca 421 gctcttctgg ctctccaagt ccttctcggc gcagacacga caacaggagg cgctcccgct 481 ccaaatccaa accacctaaa agagatgaaa aggagaggaa aaggcggagc ccatctccta 541 agcccaccaa agtgcacatt gggagactca cccggaatgt gacaaaggat cacatcatgg 601 agatattTTC CACCTATGGG AAAATTAAAA TGATTGACAT GCCCGTGGAA AGGATGCATC 661 CCCATCTGTC CAAAGGCTAT GCGTACGTAG AGTTTGAGAA TCCAGATGAA GCCGAGAAGG 721 CGCTGAAGCA CATGGATGGA GGACAAATTG ATGGCCAGGA GATCACTGCC ACCGCCGTGC 781 TGGCCCCCTG GCCTAGGCCA CCCCCCAGGA GATTCAGCCC TCCCAGGAGA ATGTTGCCAC 841 CACCGCCTAT GTGGCGCAGG TCTCCCCCAC GGATGAGGAG AAGGTCCCGC TCCCCGAGGC 901 GCAGGTCCCC CGTGCGCCGG AGATCACGGT CCCCGGGCCG CCGCCGCCAC AGGAGCCGCT 961 CCAGCTCCAA CTCCTCCCGA TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1021 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1081 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAGGG CACTCGTATT 1141 GGCCCGCTCC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt