Transcript: Human NM_006711.4

Homo sapiens RNA binding protein with serine rich domain 1 (RNPS1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
RNPS1 (10921)
Length:
2117
CDS:
342..1259

Additional Resources:

NCBI RefSeq record:
NM_006711.4
NBCI Gene record:
RNPS1 (10921)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006711.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240162 ATGGTGGTCTTTCAGGTTATC pLKO_005 1905 3UTR 100% 10.800 15.120 N RNPS1P1 n/a
2 TRCN0000350355 CATCCGTTTCCGGTTTCTAAG pLKO_005 1486 3UTR 100% 10.800 15.120 N RNPS1 n/a
3 TRCN0000000053 CGTAGAGTTTGAGAATCCAGA pLKO.1 962 CDS 100% 2.640 3.696 N RNPS1 n/a
4 TRCN0000320786 CGTAGAGTTTGAGAATCCAGA pLKO_005 962 CDS 100% 2.640 3.696 N RNPS1 n/a
5 TRCN0000240159 GATCACATCATGGAGATATTT pLKO_005 864 CDS 100% 15.000 10.500 N RNPS1P1 n/a
6 TRCN0000320788 ACATGGATGGAGGACAAATTG pLKO_005 1006 CDS 100% 13.200 9.240 N RNPS1 n/a
7 TRCN0000305220 AGCTCCAACTCCTCCCGATAA pLKO_005 1239 CDS 100% 10.800 7.560 N Rnps1 n/a
8 TRCN0000000050 TGATTGACATGCCCGTGGAAA pLKO.1 907 CDS 100% 4.950 3.465 N RNPS1 n/a
9 TRCN0000000051 TCTGTCCAAAGGCTATGCGTA pLKO.1 941 CDS 100% 2.640 1.848 N RNPS1 n/a
10 TRCN0000000052 CAGCTCCAACTCCTCCCGATA pLKO.1 1238 CDS 100% 1.350 0.945 N RNPS1 n/a
11 TRCN0000320710 CAGCTCCAACTCCTCCCGATA pLKO_005 1238 CDS 100% 1.350 0.945 N RNPS1 n/a
12 TRCN0000000049 GAAGACCAGTAGGAAAGCAAA pLKO.1 1333 3UTR 100% 4.950 2.970 N RNPS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006711.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02560 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02560 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471413 AGGGCACTCGTATTGGCCCGCTCC pLX_317 41% 100% 100% V5 n/a
Download CSV