Transcript: Human NM_023935.3

Homo sapiens DDRGK domain containing 1 (DDRGK1), mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
DDRGK1 (65992)
Length:
1303
CDS:
56..1000

Additional Resources:

NCBI RefSeq record:
NM_023935.3
NBCI Gene record:
DDRGK1 (65992)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_023935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242464 GGCTCTGCTAGTCGGCTTTAT pLKO_005 88 CDS 100% 13.200 18.480 N DDRGK1 n/a
2 TRCN0000242461 GGACTATAACAGGTGTGATTG pLKO_005 822 CDS 100% 10.800 15.120 N DDRGK1 n/a
3 TRCN0000168624 GATCCTAGATAAGCAGGTGAA pLKO.1 1172 3UTR 100% 4.050 5.670 N DDRGK1 n/a
4 TRCN0000167740 GCCAGGCAGTTATAGATTAAA pLKO.1 1094 3UTR 100% 15.000 10.500 N DDRGK1 n/a
5 TRCN0000242465 GCCAGGCAGTTATAGATTAAA pLKO_005 1094 3UTR 100% 15.000 10.500 N DDRGK1 n/a
6 TRCN0000242463 ACGCACTCAGGACACCATAAA pLKO_005 775 CDS 100% 13.200 9.240 N DDRGK1 n/a
7 TRCN0000242462 GGGCAAGTTCATCTACATAAC pLKO_005 850 CDS 100% 10.800 7.560 N DDRGK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04004 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04004 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471960 CTCACAGCATTGCCAAGGGCTGCA pLX_317 47.8% 100% 100% V5 n/a
4 ccsbBroadEn_08895 pDONR223 100% 99.7% 99.3% None 290T>C;907G>A n/a
5 ccsbBroad304_08895 pLX_304 0% 99.7% 99.3% V5 290T>C;907G>A n/a
6 TRCN0000471509 CTTCCTGTTTCTGCGATAGTGATT pLX_317 52.1% 99.7% 99.3% V5 290T>C;907G>A n/a
Download CSV