Construct: ORF TRCN0000471535
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008431.1_s317c1
- Derived from:
- ccsbBroadEn_04144
- DNA Barcode:
- GCTGATATCACACAGGAATAAGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCDC134 (79879)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471535
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79879 | CCDC134 | coiled-coil domain containi... | NM_024821.4 | 100% | 100% | |
2 | human | 79879 | CCDC134 | coiled-coil domain containi... | XM_005261748.3 | 100% | 100% | |
3 | human | 79879 | CCDC134 | coiled-coil domain containi... | NM_001304797.1 | 50.6% | 50.6% | 223_224ins339 |
4 | mouse | 76457 | Ccdc134 | coiled-coil domain containi... | NM_172428.2 | 87.6% | 89.5% | (many diffs) |
5 | mouse | 76457 | Ccdc134 | coiled-coil domain containi... | NM_001326588.1 | 74.9% | 79% | (many diffs) |
6 | mouse | 76457 | Ccdc134 | coiled-coil domain containi... | XM_006521526.2 | 68.9% | 61.5% | (many diffs) |
7 | mouse | 76457 | Ccdc134 | coiled-coil domain containi... | NR_137170.1 | 26% | (many diffs) | |
8 | mouse | 76457 | Ccdc134 | coiled-coil domain containi... | XR_001781575.1 | 16.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 753
- ORF length:
- 687
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ccttcttcaa ttcctggcct tcctctttgt cctgcttttg tctgggatgg 121 gagccacagg caccttgagg acctccctgg acccaagcct ggagatctac aagaagatgt 181 ttgaggtgaa gcggcgggag cagctgttgg cactgaagaa cctggcacag ctgaacgaca 241 tccaccagca gtacaagatc cttgatgtca tgctcaaggg gctctttaag gtgctggagg 301 actcccggac agtgctcacc gctgctgatg tgctcccaga tgggcccttc ccccaggacg 361 agaagctgaa ggatgctttc tcccacgtgg tggagaacac ggccTTCTTC GGCGATGTGG 421 TGCTGCGCTT CCCGAGGATT GTGCACTATT ACTTTGACCA CAACTCCAAC TGGAACCTCC 481 TCATCCGCTG GGGTATCAGT TTCTGCAACC AGACAGGCGT CTTCAACCAG GGGCCCCACT 541 CGCCCATCCT CAGCCTGATG GCCCAGGAGC TGGGGATCAG TGAGAAAGAC TCCAACTTCC 601 AGAACCCATT TAAAATCGAC CGCACAGAGT TCATTCCCAG CACTGACCCT TTCCAGAAGG 661 CCCTGAGAGA AGAAGAGAAA CGCCGAAAGA AAGAGGAGAA GCGGAAGGAG ATCCGAAAAG 721 GCCCAAGGAT CTCCAGATCC CAGTCTGAGT TATACCCAAC TTTCTTGTAC AAAGTGGTTG 781 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 841 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGC 901 TGATATCACA CAGGAATAAG CGACGCGTTA AGTCgacaat caacctctgg attacaaaat 961 ttgtgaaaga tt