Transcript: Human NM_024821.4

Homo sapiens coiled-coil domain containing 134 (CCDC134), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CCDC134 (79879)
Length:
1270
CDS:
105..794

Additional Resources:

NCBI RefSeq record:
NM_024821.4
NBCI Gene record:
CCDC134 (79879)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024821.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371582 CCCGAGGATTGTGCACTATTA pLKO_005 470 CDS 100% 13.200 18.480 N CCDC134 n/a
2 TRCN0000377736 TCGACCGCACAGAGTTCATTC pLKO_005 655 CDS 100% 10.800 15.120 N CCDC134 n/a
3 TRCN0000371583 CAACTTCCAGAACCCATTTAA pLKO_005 632 CDS 100% 15.000 10.500 N CCDC134 n/a
4 TRCN0000371581 CCAGATCCCAGTCTGAGTTAT pLKO_005 772 CDS 100% 13.200 9.240 N CCDC134 n/a
5 TRCN0000168119 GAAGAGAAACGCCGAAAGAAA pLKO.1 711 CDS 100% 5.625 3.938 N CCDC134 n/a
6 TRCN0000173115 CATCCACCAGCAGTACAAGAT pLKO.1 278 CDS 100% 4.950 3.465 N CCDC134 n/a
7 TRCN0000167990 CAAGATCCTTGATGTCATGCT pLKO.1 293 CDS 100% 2.640 1.848 N CCDC134 n/a
8 TRCN0000167415 GAGATCTACAAGAAGATGTTT pLKO.1 201 CDS 100% 5.625 3.375 N CCDC134 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024821.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04144 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04144 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471535 GCTGATATCACACAGGAATAAGCG pLX_317 50.7% 100% 100% V5 n/a
Download CSV