Construct: ORF TRCN0000471566
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010472.1_s317c1
- Derived from:
- ccsbBroadEn_14567
- DNA Barcode:
- CTCATACAAGCTGCTACTGCACAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CAPNS1 (826)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471566
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 826 | CAPNS1 | calpain small subunit 1 | XM_005259295.1 | 99.8% | 99.6% | 957T>A |
| 2 | human | 826 | CAPNS1 | calpain small subunit 1 | XM_005259296.1 | 99.8% | 99.6% | 957T>A |
| 3 | human | 826 | CAPNS1 | calpain small subunit 1 | NM_001003962.3 | 82.4% | 80.4% | (many diffs) |
| 4 | human | 826 | CAPNS1 | calpain small subunit 1 | NM_001302632.2 | 82.4% | 80.4% | (many diffs) |
| 5 | human | 826 | CAPNS1 | calpain small subunit 1 | NM_001749.4 | 82.4% | 80.4% | (many diffs) |
| 6 | human | 826 | CAPNS1 | calpain small subunit 1 | XM_024451732.1 | 62% | 59.4% | (many diffs) |
| 7 | human | 826 | CAPNS1 | calpain small subunit 1 | XM_011527359.1 | 61.1% | 58.8% | (many diffs) |
| 8 | human | 826 | CAPNS1 | calpain small subunit 1 | NM_001302633.2 | 47.7% | 45.8% | (many diffs) |
| 9 | mouse | 12336 | Capns1 | calpain, small subunit 1 | NM_009795.4 | 72.8% | 76.2% | (many diffs) |
| 10 | mouse | 12336 | Capns1 | calpain, small subunit 1 | XM_006539488.2 | 72.8% | 76.2% | (many diffs) |
| 11 | mouse | 12336 | Capns1 | calpain, small subunit 1 | XM_011250419.2 | 56.2% | 55.3% | (many diffs) |
| 12 | mouse | 12336 | Capns1 | calpain, small subunit 1 | XM_011250420.1 | 42.9% | 43.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1032
- ORF length:
- 966
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt cctggttaac tcgttcttga agggcggcgg cggcggcggc gggggaggcg 121 ggggcctggg tgggggcctg ggaaatgtgc ttggaggcct gatcagcggg gccgggggcg 181 gcggcggcgg cggcggcggc ggcggcggtg gtggaggcgg cggtggcggt ggaacggcca 241 tgcgcatcct aggcggagtc atcagcgcca tcagcgaggc ggctgcgcag tacaacccgg 301 agcccccgcc cccacgcaca cattactcca acattgaggc caacgagagt gaggaggtcc 361 ggcagttccg gagactcttt gcccagctgg ctggagatga catggaggtc agcgccacag 421 aactcatgaa cattctcaat aaggttgtga cacgacaccc tgatctgaag actgatggtt 481 ttggcattga cacatgtcgc agcatggtgg ccgtgatgga tagcgacacc acaggcaagc 541 tgggctttga ggaattcaag tacttgtgga acaacatcaa aaggtggcag gccatataca 601 aacagttcga cactgaccga tcagggacca tttgcagtag tgaacTCCCA GGTGCCTTTG 661 AGGCAGCAGG GTTCCACCTG AATGAGCATC TCTATAACAT GATCATCCGA CGCTACTCAG 721 ATGAAAGTGG GAACATGGAT TTTGACAACT TCATCAGCTG CTTGGTCAGG CTGGACGCCA 781 TGTTCCGTGC CTTCAAATCT CTTGACAAAG ATGGCACTGG ACAAATCCAG GTGAACATCC 841 AGGAGGTAAG GACCCCCATA TTGGGGTATG GGTGCCTGGG AGGACCCCAC CCCTCAGCCC 901 TTCATACCAG CTCTGAGCTG CAGTCCCCTT CCTCCTATTT TGCCAGCCGT CCCTGGGTGA 961 GGGCAAAGGG GCTGGTGCTC TTGGGGTTCC CTGTCCTCAC TCTCCACCCT CCTCTCCCCA 1021 GAGGCTGCAG CTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1081 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1141 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACTC ATACAAGCTG CTACTGCACA 1201 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t