Transcript: Human NM_001302632.2

Homo sapiens calpain small subunit 1 (CAPNS1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CAPNS1 (826)
Length:
1533
CDS:
213..1019

Additional Resources:

NCBI RefSeq record:
NM_001302632.2
NBCI Gene record:
CAPNS1 (826)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001302632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003544 CGCACACATTACTCCAACATT pLKO.1 462 CDS 100% 5.625 7.875 N CAPNS1 n/a
2 TRCN0000349492 CGCACACATTACTCCAACATT pLKO_005 462 CDS 100% 5.625 7.875 N CAPNS1 n/a
3 TRCN0000003548 CGCCACAGAACTCATGAACAT pLKO.1 560 CDS 100% 4.950 6.930 N CAPNS1 n/a
4 TRCN0000318473 CGCCACAGAACTCATGAACAT pLKO_005 560 CDS 100% 4.950 6.930 N CAPNS1 n/a
5 TRCN0000003545 GCAGGCCATATACAAACAGTT pLKO.1 734 CDS 100% 4.950 3.465 N CAPNS1 n/a
6 TRCN0000318536 GCAGGCCATATACAAACAGTT pLKO_005 734 CDS 100% 4.950 3.465 N CAPNS1 n/a
7 TRCN0000003546 CTTCTCAACATCCAGGGCCCA pLKO.1 1168 3UTR 100% 0.180 0.126 N CAPNS1 n/a
8 TRCN0000003547 CCATGTTCCGTGCCTTCAAAT pLKO.1 925 CDS 100% 13.200 7.920 N CAPNS1 n/a
9 TRCN0000318537 CCATGTTCCGTGCCTTCAAAT pLKO_005 925 CDS 100% 13.200 7.920 N CAPNS1 n/a
10 TRCN0000374885 GCGCCACAGAACTCATGAATA pLKO_005 559 CDS 100% 13.200 18.480 N Capns1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15374 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15374 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472246 TCTTTAAACAGATACTCCTCAATC pLX_317 57.7% 100% 100% V5 n/a
4 ccsbBroadEn_15375 pDONR223 0% 99.8% 100% None 147T>A n/a
5 ccsbBroad304_15375 pLX_304 0% 99.8% 100% V5 147T>A n/a
6 TRCN0000481024 CAGAACCCATGGATGCACATGGTT pLX_317 55.4% 99.8% 100% V5 147T>A n/a
7 ccsbBroadEn_14567 pDONR223 90.3% 82.4% 80.4% None (many diffs) n/a
8 ccsbBroad304_14567 pLX_304 0% 82.4% 80.4% V5 (many diffs) n/a
9 TRCN0000471566 CTCATACAAGCTGCTACTGCACAA pLX_317 40.2% 82.4% 80.4% V5 (many diffs) n/a
Download CSV