Transcript: Mouse NM_009795.4

Mus musculus calpain, small subunit 1 (Capns1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Capns1 (12336)
Length:
1559
CDS:
164..970

Additional Resources:

NCBI RefSeq record:
NM_009795.4
NBCI Gene record:
Capns1 (12336)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009795.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374885 GCGCCACAGAACTCATGAATA pLKO_005 510 CDS 100% 13.200 18.480 N Capns1 n/a
2 TRCN0000376763 TCCGCCTCCACGTAGTCATTA pLKO_005 403 CDS 100% 13.200 18.480 N Capns1 n/a
3 TRCN0000366317 CGGGAACATGGATTTCGATAA pLKO_005 826 CDS 100% 10.800 15.120 N Capns1 n/a
4 TRCN0000374822 ACTGACCGATCAGGGACTATC pLKO_005 710 CDS 100% 10.800 8.640 N Capns1 n/a
5 TRCN0000376695 ATCCTGACTGCAGCCGCATTT pLKO_005 1027 3UTR 100% 10.800 8.640 N Capns1 n/a
6 TRCN0000087170 GCTTTCAAATCTCTTGACAAA pLKO.1 887 CDS 100% 4.950 3.960 N Capns1 n/a
7 TRCN0000087169 GCAGGCTATATACAAACGCTT pLKO.1 685 CDS 100% 2.640 2.112 N Capns1 n/a
8 TRCN0000374886 TGTCCCTACACACCCTGTTAC pLKO_005 1323 3UTR 100% 10.800 7.560 N Capns1 n/a
9 TRCN0000087168 CTGTCTTAGTTCTGGGAGGAT pLKO.1 1296 3UTR 100% 2.640 1.848 N Capns1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009795.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15375 pDONR223 0% 88.4% 94.7% None (many diffs) n/a
2 ccsbBroad304_15375 pLX_304 0% 88.4% 94.7% V5 (many diffs) n/a
3 TRCN0000481024 CAGAACCCATGGATGCACATGGTT pLX_317 55.4% 88.4% 94.7% V5 (many diffs) n/a
4 ccsbBroadEn_15374 pDONR223 0% 88.2% 94.7% None (many diffs) n/a
5 ccsbBroad304_15374 pLX_304 0% 88.2% 94.7% V5 (many diffs) n/a
6 TRCN0000472246 TCTTTAAACAGATACTCCTCAATC pLX_317 57.7% 88.2% 94.7% V5 (many diffs) n/a
7 ccsbBroadEn_14567 pDONR223 90.3% 72.8% 76.2% None (many diffs) n/a
8 ccsbBroad304_14567 pLX_304 0% 72.8% 76.2% V5 (many diffs) n/a
9 TRCN0000471566 CTCATACAAGCTGCTACTGCACAA pLX_317 40.2% 72.8% 76.2% V5 (many diffs) n/a
Download CSV