Construct: ORF TRCN0000471725
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001146.1_s317c1
- Derived from:
- ccsbBroadEn_13304
- DNA Barcode:
- ATTGACACGCCAGGCTATGCAAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TTC39B (158219)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471725
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 158219 | TTC39B | tetratricopeptide repeat do... | NM_001168342.2 | 37.6% | 36% | (many diffs) |
| 2 | human | 158219 | TTC39B | tetratricopeptide repeat do... | XM_024447425.1 | 37.6% | 36% | (many diffs) |
| 3 | human | 158219 | TTC39B | tetratricopeptide repeat do... | XM_011517732.2 | 33.2% | 31.8% | (many diffs) |
| 4 | human | 158219 | TTC39B | tetratricopeptide repeat do... | XM_017014311.1 | 33.2% | 31.8% | (many diffs) |
| 5 | human | 158219 | TTC39B | tetratricopeptide repeat do... | XM_017014312.1 | 33.2% | 31.8% | (many diffs) |
| 6 | human | 158219 | TTC39B | tetratricopeptide repeat do... | XM_024447422.1 | 33.2% | 31.8% | (many diffs) |
| 7 | human | 158219 | TTC39B | tetratricopeptide repeat do... | XM_024447423.1 | 33.2% | 31.8% | (many diffs) |
| 8 | human | 158219 | TTC39B | tetratricopeptide repeat do... | XM_024447424.1 | 33.2% | 31.8% | (many diffs) |
| 9 | human | 158219 | TTC39B | tetratricopeptide repeat do... | NM_001168341.1 | 31.7% | 30.4% | (many diffs) |
| 10 | human | 158219 | TTC39B | tetratricopeptide repeat do... | XM_017014310.1 | 30.2% | 28.9% | (many diffs) |
| 11 | human | 158219 | TTC39B | tetratricopeptide repeat do... | NM_001168340.1 | 29.1% | 27.9% | (many diffs) |
| 12 | human | 158219 | TTC39B | tetratricopeptide repeat do... | NM_001168339.1 | 28.6% | 27.4% | (many diffs) |
| 13 | human | 158219 | TTC39B | tetratricopeptide repeat do... | NM_152574.2 | 28.5% | 27.3% | (many diffs) |
| 14 | human | 158219 | TTC39B | tetratricopeptide repeat do... | XR_001746190.1 | 8.5% | 1_1608del;2206_7023del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 663
- ORF length:
- 597
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac ctttctctgg ggctgggctg gggttcttca cagacaggtg gacagcttga 121 agcagagaat tgccgggaaa tctatcccta ctgagaagtt tgctgtgagg aaggctcggc 181 gttactccgc ctccttacct gcacctgtga agctcatctt acctgccctg gaaatgatgt 241 atgtctggaa tggtttttca atagtgagca aaagaaaaga cctttctgaa aatctgttag 301 taactgttga aaaagctgag gcagctttac aaagtcaaaa ttttaacagc ttctctgtgg 361 atgatgagtg cttagtgaag ttacttaaag gatgttgcct caagaactta cagcggccct 421 tgcaagctga actatgttac aatcatgttg tggaaagtga aaagctactg aagtatgacc 481 actacctagt gccgttcact ctatttgaat tggcatcttt gtataaaagc caggGGGAAA 541 TTGACAAGGC CATAAAGTTC CTAGAAACTG CAAGGAACAA CTACAAAGAT TACTCCCTGG 601 AGTCCAGACT ACACTTCAGA ATTCAGGCAG CTCTTCACCT CTGGAGAAAA CCTTCCTCAG 661 ATTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 721 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 781 GGCTTTATAT ATCTTGTGGA AAGGACGAAT TGACACGCCA GGCTATGCAA GAACGCGTTA 841 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt