Transcript: Human XM_024447425.1

PREDICTED: Homo sapiens tetratricopeptide repeat domain 39B (TTC39B), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC39B (158219)
Length:
2873
CDS:
145..1698

Additional Resources:

NCBI RefSeq record:
XM_024447425.1
NBCI Gene record:
TTC39B (158219)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148327 CATCGGCATCTGCTATAGATT pLKO.1 1734 3UTR 100% 5.625 7.875 N TTC39B n/a
2 TRCN0000150208 GCAAGGAACAACTACAAAGAT pLKO.1 1603 CDS 100% 5.625 7.875 N TTC39B n/a
3 TRCN0000149065 GCTAAGGAGAGTATGTACCAT pLKO.1 133 5UTR 100% 3.000 4.200 N TTC39B n/a
4 TRCN0000146417 CGGCATCTGCTATAGATTCAA pLKO.1 1737 3UTR 100% 5.625 3.938 N TTC39B n/a
5 TRCN0000148825 CTGAAGTATGACCACTACCTA pLKO.1 1501 CDS 100% 3.000 2.100 N TTC39B n/a
6 TRCN0000147265 GAATGGAAACAGTTTCACCAT pLKO.1 922 CDS 100% 2.640 1.848 N TTC39B n/a
7 TRCN0000148681 CCAGCAAGGATTATCAGACTA pLKO.1 595 CDS 100% 4.950 2.970 N TTC39B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14414 pDONR223 100% 83.3% 83.2% None (many diffs) n/a
2 ccsbBroad304_14414 pLX_304 0% 83.3% 83.2% V5 (many diffs) n/a
3 ccsbBroadEn_13304 pDONR223 100% 37.6% 36% None (many diffs) n/a
4 ccsbBroad304_13304 pLX_304 0% 37.6% 36% V5 (many diffs) n/a
5 TRCN0000471725 ATTGACACGCCAGGCTATGCAAGA pLX_317 22.5% 37.6% 36% V5 (many diffs) n/a
Download CSV