Construct: ORF TRCN0000471731
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013282.1_s317c1
- Derived from:
- ccsbBroadEn_05193
- DNA Barcode:
- CTCGAGTCGAGCCTTTATCTGTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCTD6 (200845)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471731
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 200845 | KCTD6 | potassium channel tetrameri... | NM_001128214.2 | 100% | 100% | |
| 2 | human | 200845 | KCTD6 | potassium channel tetrameri... | NM_153331.3 | 100% | 100% | |
| 3 | human | 200845 | KCTD6 | potassium channel tetrameri... | XM_005264937.2 | 100% | 100% | |
| 4 | mouse | 71393 | Kctd6 | potassium channel tetrameri... | NM_001305936.1 | 88.7% | 99.1% | (many diffs) |
| 5 | mouse | 71393 | Kctd6 | potassium channel tetrameri... | NM_001305937.1 | 88.7% | 99.1% | (many diffs) |
| 6 | mouse | 71393 | Kctd6 | potassium channel tetrameri... | NM_027782.3 | 88.7% | 99.1% | (many diffs) |
| 7 | mouse | 71393 | Kctd6 | potassium channel tetrameri... | XM_006518105.3 | 88.7% | 99.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 777
- ORF length:
- 711
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga taatggagac tggggctata tgatgactga cccagtcaca ttaaatgtag 121 gtggacactt gtatacaacg tctctcacca cattgacgcg ttacccggat tccatgcttg 181 gagctatgtt tgggggggac ttccccacag ctcgagaccc tcaaggcaat tactttattg 241 atcgagatgg acctcttttc cgatatgtcc tcaacttctt aagaacttca gaattgacct 301 taccgttgga ttttaaggaa tttgatctgc ttcggaaaga agcagatttt taccagattg 361 agcccttgat tcagtgtctc aatgatccTA AGCCTTTGTA TCCCATGGAT ACTTTTGAAG 421 AAGTTGTGGA GCTGTCTAGT ACTCGGAAGC TTTCTAAGTA CTCCAACCCA GTGGCTGTCA 481 TCATAACGCA ACTAACCATC ACCACTAAGG TCCATTCCTT ACTAGAAGGC ATCTCAAATT 541 ATTTTACCAA GTGGAATAAG CACATGATGG ACACCAGAGA CTGCCAGGTT TCCTTTACTT 601 TTGGACCCTG TGATTATCAC CAGGAAGTTT CTCTTAGGGT CCACCTGATG GAATACATTA 661 CAAAACAAGG TTTCACGATC CGCAACACCC GGGTGCATCA CATGAGTGAG CGGGCCAATG 721 AAAACACAGT GGAGCACAAC TGGACTTTCT GTAGGCTAGC CCGGAAGACA GACGACTGCC 781 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 841 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 901 ATATATCTTG TGGAAAGGAC GACTCGAGTC GAGCCTTTAT CTGTGCACGC GTTAAGTCga 961 caatcaacct ctggattaca aaatttgtga aagatt