Transcript: Mouse XM_006518105.3

PREDICTED: Mus musculus potassium channel tetramerisation domain containing 6 (Kctd6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kctd6 (71393)
Length:
4268
CDS:
2841..3554

Additional Resources:

NCBI RefSeq record:
XM_006518105.3
NBCI Gene record:
Kctd6 (71393)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518105.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068866 CCGTCATCATCACCCAGTTAA pLKO.1 3250 CDS 100% 13.200 18.480 N Kctd6 n/a
2 TRCN0000068867 CGGATTCTATGCTTGGAGCTA pLKO.1 2941 CDS 100% 2.640 2.112 N Kctd6 n/a
3 TRCN0000068864 CGAAGGCATCTCAAACTATTT pLKO.1 3299 CDS 100% 13.200 9.240 N Kctd6 n/a
4 TRCN0000068863 CCCTTGATTCAGTGTCTCAAT pLKO.1 3138 CDS 100% 4.950 3.465 N Kctd6 n/a
5 TRCN0000068865 CCTCAAGGCAATTACTTCATT pLKO.1 2994 CDS 100% 5.625 3.375 N Kctd6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518105.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05193 pDONR223 100% 88.7% 99.1% None (many diffs) n/a
2 ccsbBroad304_05193 pLX_304 0% 88.7% 99.1% V5 (many diffs) n/a
3 TRCN0000471731 CTCGAGTCGAGCCTTTATCTGTGC pLX_317 54.5% 88.7% 99.1% V5 (many diffs) n/a
4 TRCN0000489946 TAATTGCCAGGGTCGAAGCCGTTA pLX_317 39.9% 85% 95.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV