Transcript: Mouse NM_027782.3

Mus musculus potassium channel tetramerisation domain containing 6 (Kctd6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Kctd6 (71393)
Length:
1734
CDS:
306..1019

Additional Resources:

NCBI RefSeq record:
NM_027782.3
NBCI Gene record:
Kctd6 (71393)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027782.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068866 CCGTCATCATCACCCAGTTAA pLKO.1 715 CDS 100% 13.200 18.480 N Kctd6 n/a
2 TRCN0000068867 CGGATTCTATGCTTGGAGCTA pLKO.1 406 CDS 100% 2.640 2.112 N Kctd6 n/a
3 TRCN0000068864 CGAAGGCATCTCAAACTATTT pLKO.1 764 CDS 100% 13.200 9.240 N Kctd6 n/a
4 TRCN0000068863 CCCTTGATTCAGTGTCTCAAT pLKO.1 603 CDS 100% 4.950 3.465 N Kctd6 n/a
5 TRCN0000068865 CCTCAAGGCAATTACTTCATT pLKO.1 459 CDS 100% 5.625 3.375 N Kctd6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027782.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05193 pDONR223 100% 88.7% 99.1% None (many diffs) n/a
2 ccsbBroad304_05193 pLX_304 0% 88.7% 99.1% V5 (many diffs) n/a
3 TRCN0000471731 CTCGAGTCGAGCCTTTATCTGTGC pLX_317 54.5% 88.7% 99.1% V5 (many diffs) n/a
4 TRCN0000489946 TAATTGCCAGGGTCGAAGCCGTTA pLX_317 39.9% 85% 95.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV