Construct: ORF TRCN0000471783
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009749.1_s317c1
- Derived from:
- ccsbBroadEn_00426
- DNA Barcode:
- TTGCTGGCTACCCGAGCTAGAACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DCN (1634)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471783
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1634 | DCN | decorin | NM_001920.5 | 100% | 100% | |
| 2 | human | 1634 | DCN | decorin | NM_133503.3 | 100% | 100% | |
| 3 | human | 1634 | DCN | decorin | NM_133504.3 | 69.6% | 69.6% | 210_211ins327 |
| 4 | human | 1634 | DCN | decorin | NM_133505.3 | 59% | 59% | 210_211ins441 |
| 5 | human | 1634 | DCN | decorin | NM_133506.3 | 47.9% | 47.9% | 324_325ins561 |
| 6 | human | 1634 | DCN | decorin | NM_133507.3 | 20.7% | 20% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1143
- ORF length:
- 1077
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ggccactatc atcctccttc tgcttgcaca agtttcctgg gctggaccgt 121 ttcaacagag aggcttattt gactttatgc tagaagatga ggcttctggg ataggcccag 181 aagttcctga tgaccgcgac ttcgagccct ccctaggccc agtgtgcccc ttccgctgtc 241 aatgccatct tcgagtggtc cagtgttctg atttgggtct ggacaaagtg ccaaaggatc 301 ttccccctga cacaactctg ctagacctgc aaaacaacaa aataaccgaa atcaaagatg 361 gagactttaa gaacctgaag aaccttcacg cattgattct tgtcaacaat aaaattagca 421 aagttagtcc tggagcattt acacctttgg tgaagttgga acgactttat ctgtccaaga 481 atcagctgaa ggaattgcca gaaaaaatgc ccaaaactct tcaggagctg cgtgcccatg 541 agaatgagat caccaaagtg cgaaaagtta ctttcaatgg actgaaccag atgattgtca 601 tagaactggg caccaatCCG CTGAAGAGCT CAGGAATTGA AAATGGGGCT TTCCAGGGAA 661 TGAAGAAGCT CTCCTACATC CGCATTGCTG ATACCAATAT CACCAGCATT CCTCAAGGTC 721 TTCCTCCTTC CCTTACGGAA TTACATCTTG ATGGCAACAA AATCAGCAGA GTTGATGCAG 781 CTAGCCTGAA AGGACTGAAT AATTTGGCTA AGTTGGGATT GAGTTTCAAC AGCATCTCTG 841 CTGTTGACAA TGGCTCTCTG GCCAACACGC CTCATCTGAG GGAGCTTCAC TTGGACAACA 901 ACAAGCTTAC CAGAGTACCT GGTGGGCTGG CAGAGCATAA GTACATCCAG GTTGTCTACC 961 TTCATAACAA CAATATCTCT GTAGTTGGAT CAAGTGACTT CTGCCCACCT GGACACAACA 1021 CCAAAAAGGC TTCTTATTCG GGTGTGAGTC TTTTCAGCAA CCCGGTCCAG TACTGGGAGA 1081 TACAGCCATC CACCTTCAGA TGTGTCTACG TGCGCTCTGC CATTCAACTC GGAAACTATA 1141 AGTATCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1201 TCGGTCTCGA TTCTACGTAG TAATGAACTA GCCCGTAACT TGAAAGTATT TCGATTTCTT 1261 GGCTTTATAT ATCTTGTGGA AAGGACGATT GCTGGCTACC CGAGCTAGAA CGACGCGTTA 1321 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt