Transcript: Human NM_133505.3

Homo sapiens decorin (DCN), transcript variant C, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
DCN (1634)
Length:
3529
CDS:
95..733

Additional Resources:

NCBI RefSeq record:
NM_133505.3
NBCI Gene record:
DCN (1634)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133505.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233501 ACTCGGAAACTATAAGTAATT pLKO_005 715 CDS 100% 13.200 10.560 N DCN n/a
2 TRCN0000233502 TTTACCCACATGACTTATTAT pLKO_005 840 3UTR 100% 15.000 10.500 N DCN n/a
3 TRCN0000058557 CCAGGTTGTCTACCTTCATAA pLKO.1 535 CDS 100% 13.200 9.240 N DCN n/a
4 TRCN0000058555 GCCATTCAACTCGGAAACTAT pLKO.1 707 CDS 100% 5.625 3.938 N DCN n/a
5 TRCN0000058553 GCCTCATTTGAATGTGTGAAT pLKO.1 1170 3UTR 100% 4.950 3.465 N DCN n/a
6 TRCN0000058556 CCGTTTCAACAGAGAGGCTTA pLKO.1 146 CDS 100% 4.050 2.835 N DCN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133505.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00426 pDONR223 100% 59% 59% None 210_211ins441 n/a
2 ccsbBroad304_00426 pLX_304 0% 59% 59% V5 210_211ins441 n/a
3 TRCN0000471783 TTGCTGGCTACCCGAGCTAGAACG pLX_317 48.8% 59% 59% V5 210_211ins441 n/a
Download CSV