Transcript: Human NM_001920.5

Homo sapiens decorin (DCN), transcript variant A1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
DCN (1634)
Length:
6850
CDS:
197..1276

Additional Resources:

NCBI RefSeq record:
NM_001920.5
NBCI Gene record:
DCN (1634)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001920.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233501 ACTCGGAAACTATAAGTAATT pLKO_005 1258 CDS 100% 13.200 10.560 N DCN n/a
2 TRCN0000233502 TTTACCCACATGACTTATTAT pLKO_005 1383 3UTR 100% 15.000 10.500 N DCN n/a
3 TRCN0000058557 CCAGGTTGTCTACCTTCATAA pLKO.1 1078 CDS 100% 13.200 9.240 N DCN n/a
4 TRCN0000233500 CCGCATTGCTGATACCAATAT pLKO_005 811 CDS 100% 13.200 9.240 N DCN n/a
5 TRCN0000233499 GGTGAAGTTGGAACGACTTTA pLKO_005 580 CDS 100% 13.200 9.240 N DCN n/a
6 TRCN0000058554 CGACTTTATCTGTCCAAGAAT pLKO.1 593 CDS 100% 5.625 3.938 N DCN n/a
7 TRCN0000058555 GCCATTCAACTCGGAAACTAT pLKO.1 1250 CDS 100% 5.625 3.938 N DCN n/a
8 TRCN0000058553 GCCTCATTTGAATGTGTGAAT pLKO.1 1713 3UTR 100% 4.950 3.465 N DCN n/a
9 TRCN0000058556 CCGTTTCAACAGAGAGGCTTA pLKO.1 248 CDS 100% 4.050 2.835 N DCN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001920.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00426 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00426 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471783 TTGCTGGCTACCCGAGCTAGAACG pLX_317 48.8% 100% 100% V5 n/a
Download CSV