Construct: ORF TRCN0000471793
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018449.1_s317c1
- Derived from:
- ccsbBroadEn_01936
- DNA Barcode:
- GTGCATGTCAGGCACGTTTTCAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAE1 (8480)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471793
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8480 | RAE1 | ribonucleic acid export 1 | NM_001015885.1 | 100% | 100% | |
2 | human | 8480 | RAE1 | ribonucleic acid export 1 | NM_003610.4 | 100% | 100% | |
3 | human | 8480 | RAE1 | ribonucleic acid export 1 | XM_005260582.2 | 100% | 100% | |
4 | human | 8480 | RAE1 | ribonucleic acid export 1 | XM_011529088.2 | 100% | 100% | |
5 | human | 8480 | RAE1 | ribonucleic acid export 1 | XM_011529089.1 | 100% | 100% | |
6 | human | 8480 | RAE1 | ribonucleic acid export 1 | XM_011529087.2 | 94.4% | 90.2% | (many diffs) |
7 | human | 8480 | RAE1 | ribonucleic acid export 1 | XM_017028108.2 | 94.4% | 90.2% | (many diffs) |
8 | human | 8480 | RAE1 | ribonucleic acid export 1 | XM_005260583.2 | 90.6% | 90.6% | 1_114del |
9 | mouse | 66679 | Rae1 | ribonucleic acid export 1 | NM_175112.5 | 88.6% | 98.6% | (many diffs) |
10 | mouse | 66679 | Rae1 | ribonucleic acid export 1 | XM_006500023.1 | 88.6% | 98.6% | (many diffs) |
11 | mouse | 66679 | Rae1 | ribonucleic acid export 1 | XM_006500024.3 | 88.6% | 98.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1173
- ORF length:
- 1104
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagcctgttt ggaacaacct caggttttgg aaccagtggg accagcatgt 121 ttggcagtgc aactacagac aatcacaatc ccatgaagga tattgaagta acatcatctc 181 ctgatgatag cattggttgt ctgtctttta gcccaccaac cttgccgggg aactttctta 241 ttgcaggatc atgggctaat gatgttcgct gctgggaagt tcaagacagt ggacagacca 301 ttccaaaagc ccagcagatg cacactgggc ctgtgcttga tgtctgctgg agtgacgatg 361 ggagcaaagt gtttacggca tcgtgtgata aaactgccaa aatgtgggac ctcagcagta 421 accaagcgat acagatcgca cagcatgatg ctcctgttaa aaccatccat tggatcaaag 481 ctccaaacta cagctgtgtg atgactggga gctgggataa gactttaaag ttttgggata 541 ctcgatcgtc aaatcctatg atggttttgc aactccctga aaggtgttac tgtgctgacg 601 tgatataccc catggctgtg gtggcaactg cagagagggg cctgattgtc tatcagctag 661 agaatcaacc ttctgaattc aggaggatag aatctccact gaaacatcag catcggtgtg 721 tggctatttt taaagacaaa cagaacaagc ctactggttt tgccctggga agtatcgagg 781 ggagagttgc tattcactat atcaaccccc cgaaccccgc caaagataac ttcaccttta 841 aatgtcatcg atcTAATGGA ACCAACACTT CAGCTCCTCA GGACATTTAT GCGGTAAATG 901 GAATCGCGTT CCATCCTGTT CATGGCACCC TTGCAACTGT GGGATCTGAT GGTAGATTCA 961 GCTTCTGGGA CAAAGATGCC AGAACAAAAC TAAAAACTTC GGAACAGTTA GATCAGCCCA 1021 TCTCAGCTTG CTGTTTCAAT CACAATGGAA ACATATTTGC ATACGCTTCC AGCTACGACT 1081 GGTCAAAGGG ACATGAATTT TATAATCCCC AGAAAAAAAA TTACATTTTC CTGCGTAATG 1141 CAGCCGAAGA GCTAAAGCCC AGGAATAAGA AGTTGCCAAC TTTCTTGTAC AAAGTGGTTG 1201 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1261 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGT 1321 GCATGTCAGG CACGTTTTCA GAACGCGTTA AGTCgacaat caacctctgg attacaaaat 1381 ttgtgaaaga tt