Transcript: Mouse XM_006500023.1

PREDICTED: Mus musculus ribonucleic acid export 1 (Rae1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rae1 (66679)
Length:
1563
CDS:
145..1251

Additional Resources:

NCBI RefSeq record:
XM_006500023.1
NBCI Gene record:
Rae1 (66679)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500023.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102233 CCACAATCCAATGAAGGATAT pLKO.1 219 CDS 100% 10.800 15.120 N Rae1 n/a
2 TRCN0000323634 CCACAATCCAATGAAGGATAT pLKO_005 219 CDS 100% 10.800 15.120 N Rae1 n/a
3 TRCN0000102232 GCTCCTGTTAAGACCATACAT pLKO.1 526 CDS 100% 5.625 7.875 N Rae1 n/a
4 TRCN0000349029 GCAACTCCCTGAACGCTGTTA pLKO_005 645 CDS 100% 4.950 3.960 N Rae1 n/a
5 TRCN0000305592 ATCACAATGGAAACATATTTG pLKO_005 1115 CDS 100% 13.200 9.240 N Rae1 n/a
6 TRCN0000102230 CTGGGACTGTTGGAGTTTCAT pLKO.1 1262 3UTR 100% 5.625 3.938 N Rae1 n/a
7 TRCN0000323565 CTGGGACTGTTGGAGTTTCAT pLKO_005 1262 3UTR 100% 5.625 3.938 N Rae1 n/a
8 TRCN0000102231 GCGGTCCTCAAATCCTATGAT pLKO.1 618 CDS 100% 5.625 3.938 N Rae1 n/a
9 TRCN0000323636 GCGGTCCTCAAATCCTATGAT pLKO_005 618 CDS 100% 5.625 3.938 N Rae1 n/a
10 TRCN0000102234 TCACTACATCAACCCTCCAAA pLKO.1 870 CDS 100% 4.950 3.465 N Rae1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500023.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01936 pDONR223 100% 88.6% 98.6% None (many diffs) n/a
2 ccsbBroad304_01936 pLX_304 0% 88.6% 98.6% V5 (many diffs) n/a
3 TRCN0000471793 GTGCATGTCAGGCACGTTTTCAGA pLX_317 29.2% 88.6% 98.6% V5 (many diffs) n/a
Download CSV