Construct: ORF TRCN0000471795
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012492.1_s317c1
- Derived from:
- ccsbBroadEn_04237
- DNA Barcode:
- AGTTCTACAACCCCCCTCAGGTGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LMAN2L (81562)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471795
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 81562 | LMAN2L | lectin, mannose binding 2 like | NM_030805.3 | 100% | 100% | |
| 2 | human | 81562 | LMAN2L | lectin, mannose binding 2 like | NM_001142292.1 | 96.9% | 96.9% | 506_538del |
| 3 | human | 81562 | LMAN2L | lectin, mannose binding 2 like | NM_001322346.1 | 60.8% | 51.2% | (many diffs) |
| 4 | human | 81562 | LMAN2L | lectin, mannose binding 2 like | NM_001322354.1 | 60.8% | 51.2% | (many diffs) |
| 5 | human | 81562 | LMAN2L | lectin, mannose binding 2 like | NM_001322350.1 | 60.3% | 60.3% | 0_1ins414 |
| 6 | human | 81562 | LMAN2L | lectin, mannose binding 2 like | XM_024453167.1 | 60.3% | 60.3% | 0_1ins414 |
| 7 | human | 81562 | LMAN2L | lectin, mannose binding 2 like | NM_001322347.1 | 58.4% | 58.4% | 0_1ins414;92_124del |
| 8 | human | 81562 | LMAN2L | lectin, mannose binding 2 like | NM_001322352.1 | 58.4% | 58.4% | 0_1ins414;92_124del |
| 9 | human | 81562 | LMAN2L | lectin, mannose binding 2 like | NM_001322351.1 | 58.3% | 52.2% | 0_1ins352;70_71ins83 |
| 10 | human | 81562 | LMAN2L | lectin, mannose binding 2 like | NM_001322355.1 | 58.3% | 52.2% | 0_1ins352;70_71ins83 |
| 11 | human | 81562 | LMAN2L | lectin, mannose binding 2 like | NM_001322356.1 | 58.3% | 52.2% | 0_1ins352;70_71ins83 |
| 12 | mouse | 214895 | Lman2l | lectin, mannose-binding 2-like | NM_001013374.2 | 88.9% | 90.5% | (many diffs) |
| 13 | mouse | 214895 | Lman2l | lectin, mannose-binding 2-like | NM_001310517.1 | 86.2% | 87.7% | (many diffs) |
| 14 | mouse | 214895 | Lman2l | lectin, mannose-binding 2-like | XM_006495855.3 | 54.8% | 57.1% | (many diffs) |
| 15 | mouse | 214895 | Lman2l | lectin, mannose-binding 2-like | XM_006495854.3 | 53.1% | 55.4% | (many diffs) |
| 16 | mouse | 214895 | Lman2l | lectin, mannose-binding 2-like | XM_017319753.1 | 53.1% | 55.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1110
- ORF length:
- 1044
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcgactctg ggaccccttg ggtcgtggca gcagtggcgg cgatgtttgt 121 cggctcggga tgggtccagg atgttactcc ttcttctttt gttggggtct gggcaggggc 181 cacagcaagt cggggcgggt caaacgttcg agtacttgaa acgggagcac tcgctgtcga 241 agccctacca gggtgtgggc acaggcagtt cctcactgtg gaatctgatg ggcaatgcca 301 tggtgatgac ccagtatatc cgccttaccc cagatatgca aagtaaacag ggtgccttgt 361 ggaaccgggt gccatgtttc ctgagagact gggagttgca ggtgcacttc aaaatccatg 421 gacaaggaaa gaagaatctg catggggatg gcttggcaat ctggtacaca aaggatcgga 481 tgcagccagg gcctgtgttt ggaaacatgg acaaatttgt ggggctggga gtatttgtag 541 acacctaccc caatgaggag aagcagcaag agcgggtatt cccctacatc tcagccatgg 601 tgaacaacgg ctccctcagc tatgatcatg agcgggatgg gcggcctaca gagctgggag 661 gctgcacagc cattgtccgc aatcttcatt acgacacctt ccTGGTGATT CGCTACGTCA 721 AGAGGCATTT GACGATAATG ATGGATATTG ATGGCAAGCA TGAGTGGAGG GACTGCATTG 781 AAGTGCCCGG AGTCCGCCTG CCCCGCGGCT ACTACTTCGG CACCTCCTCC ATCACTGGGG 841 ATCTCTCAGA TAATCATGAT GTCATTTCCT TGAAGTTGTT TGAACTGACA GTGGAGAGAA 901 CCCCAGAAGA GGAAAAGCTC CATCGAGATG TGTTCTTGCC CTCAGTGGAC AATATGAAGC 961 TGCCTGAGAT GACAGCTCCA CTGCCGCCCC TGAGTGGCCT GGCCCTCTTC CTCATCGTCT 1021 TTTTCTCCCT GGTGTTTTCT GTATTTGCCA TAGTCATTGG TATCATACTC TACAACAAAT 1081 GGCAGGAACA GAGCCGAAAG CGCTTCTACT GCCCAACTTT CTTGTACAAA GTGGTTGATA 1141 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1201 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAAGTTC 1261 TACAACCCCC CTCAGGTGGA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1321 tgaaagatt