Transcript: Human NM_001322346.1

Homo sapiens lectin, mannose binding 2 like (LMAN2L), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
LMAN2L (81562)
Length:
2391
CDS:
405..1049

Additional Resources:

NCBI RefSeq record:
NM_001322346.1
NBCI Gene record:
LMAN2L (81562)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152083 CAAACGTTCGAGTACTTGAAA pLKO.1 188 5UTR 100% 5.625 7.875 N LMAN2L n/a
2 TRCN0000154515 GCTCCATCGAGATGTGTTCTT pLKO.1 854 CDS 100% 4.950 6.930 N LMAN2L n/a
3 TRCN0000154776 GCTTGGCAATCTGGTACACAA pLKO.1 438 CDS 100% 4.950 6.930 N LMAN2L n/a
4 TRCN0000151609 GAGGCATTTGACGATAATGAT pLKO.1 659 CDS 100% 5.625 3.938 N LMAN2L n/a
5 TRCN0000151114 GCCATAGTCATTGGTATCATA pLKO.1 984 CDS 100% 5.625 3.938 N LMAN2L n/a
6 TRCN0000154993 GCCCTCAGTGGACAATATGAA pLKO.1 875 CDS 100% 5.625 3.938 N LMAN2L n/a
7 TRCN0000153802 CAATATGAAGCTGCCTGAGAT pLKO.1 887 CDS 100% 4.950 3.465 N LMAN2L n/a
8 TRCN0000111712 CTTGGCAATCTGGTACACAAA pLKO.1 439 CDS 100% 4.950 3.465 N Lman2l n/a
9 TRCN0000154751 GCTTGGATATTGCCCAGAGAA pLKO.1 2044 3UTR 100% 4.950 3.465 N LMAN2L n/a
10 TRCN0000154378 CCCTCAGTGAAGTTTGGCTAA pLKO.1 1785 3UTR 100% 4.050 2.430 N LMAN2L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04237 pDONR223 100% 60.8% 51.2% None (many diffs) n/a
2 ccsbBroad304_04237 pLX_304 0% 60.8% 51.2% V5 (many diffs) n/a
3 TRCN0000471795 AGTTCTACAACCCCCCTCAGGTGG pLX_317 39.2% 60.8% 51.2% V5 (many diffs) n/a
Download CSV