Transcript: Mouse XM_017319753.1

PREDICTED: Mus musculus lectin, mannose-binding 2-like (Lman2l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lman2l (214895)
Length:
3385
CDS:
422..1087

Additional Resources:

NCBI RefSeq record:
XM_017319753.1
NBCI Gene record:
Lman2l (214895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111710 CCTGCTGTGATGCCTAAATTA pLKO.1 1336 3UTR 100% 15.000 21.000 N Lman2l n/a
2 TRCN0000111711 GCACAGCCATTGTCCGAAATA pLKO.1 639 CDS 100% 13.200 18.480 N Lman2l n/a
3 TRCN0000111714 TGCACAGCCATTGTCCGAAAT pLKO.1 638 CDS 100% 10.800 15.120 N Lman2l n/a
4 TRCN0000111713 CGGGATCATACTCTACAACAA pLKO.1 1033 CDS 100% 4.950 3.465 N Lman2l n/a
5 TRCN0000111712 CTTGGCAATCTGGTACACAAA pLKO.1 394 5UTR 100% 4.950 3.465 N Lman2l n/a
6 TRCN0000154776 GCTTGGCAATCTGGTACACAA pLKO.1 393 5UTR 100% 4.950 3.465 N LMAN2L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04237 pDONR223 100% 53.1% 55.4% None (many diffs) n/a
2 ccsbBroad304_04237 pLX_304 0% 53.1% 55.4% V5 (many diffs) n/a
3 TRCN0000471795 AGTTCTACAACCCCCCTCAGGTGG pLX_317 39.2% 53.1% 55.4% V5 (many diffs) n/a
Download CSV