Construct: ORF TRCN0000471813
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009499.1_s317c1
- Derived from:
- ccsbBroadEn_06239
- DNA Barcode:
- GCGGTCAAACGATAACCCGCAGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GABRA3 (2556)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471813
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2556 | GABRA3 | gamma-aminobutyric acid typ... | NM_000808.4 | 99.9% | 99.7% | 539T>C |
2 | human | 2556 | GABRA3 | gamma-aminobutyric acid typ... | XM_006724811.3 | 69% | 62.3% | 539T>C;930_931ins212;1020_1021ins244 |
3 | mouse | 14396 | Gabra3 | gamma-aminobutyric acid (GA... | NM_008067.4 | 90.6% | 95.7% | (many diffs) |
4 | mouse | 14396 | Gabra3 | gamma-aminobutyric acid (GA... | XM_006527823.3 | 90.6% | 95.7% | (many diffs) |
5 | mouse | 14396 | Gabra3 | gamma-aminobutyric acid (GA... | XM_011247522.2 | 90.6% | 95.7% | (many diffs) |
6 | mouse | 14396 | Gabra3 | gamma-aminobutyric acid (GA... | XM_017318383.1 | 85.3% | 90% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1542
- ORF length:
- 1476
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat aatcacacaa acaagtcact gttacatgac cagccttggg attcttttcc 121 tgattaatat tctccctgga accactggtc aaggggaatc aagacgacaa gaacccgggg 181 actttgtgaa gcaggacatt ggcgggctgt ctcctaagca tgccccagat attcctgatg 241 acagcactga caacatcact atcttcacca gaatcttgga tcgtcttctg gacggctatg 301 acaaccggct gcgacctggg cttggagatg cagtgactga agtgaagact gacatctacg 361 tgaccagttt tggccctgtg tcagacactg acatggagta cactattgat gtattttttc 421 ggcagacatg gcatgatgaa agactgaaat ttgatggccc catgaagatc cttccactga 481 acaatctcct ggctagtaag atctggacac cggacacctt cttccacaat ggcaagaaat 541 cagtggctca taacatgacc acgcccaaca agctgctcag attggtggac aacggaaccc 601 tcccctatac aatgaggtta acaattcatg ctgagtgtcc catgcatttg gaagattttc 661 ccatggatgt gcatgcctgc ccactgaagt ttggaagcta tgcctataca acagctgaag 721 tggtttattc ttggactctc ggaaagaaca aatccgtgga agtggcacag gatggttctc 781 gcttgaacca gtatgacctt ttgggccatg ttgttgggac agagataatc cggtctagta 841 caggagaata tgtcgtcatg acaacccact tccatctcaa gcgaaaaatt ggctactttg 901 tgatccagac ctacttgcca tgtatcatga ctgtcattct gtcacaagtg tcgttctggc 961 tcaacagaga gtctgttcct gcccgtacag tctttggtgt caccactgtg cttaccatga 1021 ccaccttgag tatcagtgcc agaaattcct tacctaaagt ggcatatgcg acggccatgg 1081 actggttcat agccgtctgt tatgcctttg tattttctgc actgattgaa tttgccactg 1141 tcaactattt caccaagcgg agttgggctt gggaaggcaa gaaggtgcca gaggccctgg 1201 agatGAAGAA GAAAACACCA GCAGCCCCAG CAAAGAAAAC CAGCACTACC TTCAACATCG 1261 TGGGGACCAC CTATCCCATC AACCTGGCCA AGGACACTGA ATTTTCCACC ATCTCCAAGG 1321 GCGCTGCTCC CAGTGCCTCC TCAACCCCAA CAATCATTGC TTCACCCAAG GCCACCTACG 1381 TGCAGGACAG CCCGACTGAG ACCAAGACCT ACAACAGTGT CAGCAAGGTT GACAAAATTT 1441 CCCGCATCAT CTTTCCTGTG CTCTTTGCCA TATTCAATCT GGTCTATTGG GCCACATATG 1501 TCAACCGGGA GTCAGCTATC AAGGGCATGA TCCGCAAACA GTACCCAACT TTCTTGTACA 1561 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1621 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1681 AGGACGAGCG GTCAAACGAT AACCCGCAGT CACGCGTTAA GTCgacaatc aacctctgga 1741 ttacaaaatt tgtgaaagat t