Transcript: Human XM_006724811.3

PREDICTED: Homo sapiens gamma-aminobutyric acid type A receptor alpha3 subunit (GABRA3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GABRA3 (2556)
Length:
3483
CDS:
223..1245

Additional Resources:

NCBI RefSeq record:
XM_006724811.3
NBCI Gene record:
GABRA3 (2556)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724811.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426309 ACTGACATGGAGTACACTATT pLKO_005 544 CDS 100% 13.200 10.560 N GABRA3 n/a
2 TRCN0000061211 CACTGACAACATCACTATCTT pLKO.1 402 CDS 100% 5.625 4.500 N GABRA3 n/a
3 TRCN0000420690 CTCCAATATTGCCCAGTATAA pLKO_005 1673 3UTR 100% 13.200 9.240 N GABRA3 n/a
4 TRCN0000061209 CCAGACCTACTTGCCATGTAT pLKO.1 1062 CDS 100% 5.625 3.938 N GABRA3 n/a
5 TRCN0000009890 GGGAATCAAGACGACAAGAAC pLKO.1 311 CDS 100% 4.950 3.465 N Gabra3 n/a
6 TRCN0000061210 GTCAGCTATCAAGGGCATGAT pLKO.1 1456 3UTR 100% 4.950 3.465 N GABRA3 n/a
7 TRCN0000061212 CCCACTGAAGTTTGGAAGCTA pLKO.1 837 CDS 100% 3.000 2.100 N GABRA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724811.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06239 pDONR223 100% 69% 62.3% None 539T>C;930_931ins212;1020_1021ins244 n/a
2 ccsbBroad304_06239 pLX_304 0% 69% 62.3% V5 539T>C;930_931ins212;1020_1021ins244 n/a
3 TRCN0000471813 GCGGTCAAACGATAACCCGCAGTC pLX_317 23.2% 69% 62.3% V5 539T>C;930_931ins212;1020_1021ins244 n/a
Download CSV