Transcript: Mouse XM_011247522.2

PREDICTED: Mus musculus gamma-aminobutyric acid (GABA) A receptor, subunit alpha 3 (Gabra3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gabra3 (14396)
Length:
3770
CDS:
322..1800

Additional Resources:

NCBI RefSeq record:
XM_011247522.2
NBCI Gene record:
Gabra3 (14396)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061208 GCCGTCTGTTATGCCTTTGTA pLKO.1 1348 CDS 100% 5.625 7.875 N GABRA3 n/a
2 TRCN0000009890 GGGAATCAAGACGACAAGAAC pLKO.1 410 CDS 100% 4.950 6.930 N Gabra3 n/a
3 TRCN0000009895 TACCTAAAGTGGCATACGCGA pLKO.1 1307 CDS 100% 0.000 0.000 N Gabra3 n/a
4 TRCN0000009894 CTTCGACCTGGACTTGGAGAT pLKO.1 565 CDS 100% 4.050 2.835 N Gabra3 n/a
5 TRCN0000009896 CCTTCAACATAGTGGGTACCA pLKO.1 1502 CDS 100% 0.000 0.000 N Gabra3 n/a
6 TRCN0000061209 CCAGACCTACTTGCCATGTAT pLKO.1 1161 CDS 100% 5.625 3.375 N GABRA3 n/a
7 TRCN0000009897 GCTGAGACCAAGACCTACAAC pLKO.1 1651 CDS 100% 4.950 2.970 N Gabra3 n/a
8 TRCN0000061212 CCCACTGAAGTTTGGAAGCTA pLKO.1 936 CDS 100% 3.000 1.800 N GABRA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06239 pDONR223 100% 90.6% 95.7% None (many diffs) n/a
2 ccsbBroad304_06239 pLX_304 0% 90.6% 95.7% V5 (many diffs) n/a
3 TRCN0000471813 GCGGTCAAACGATAACCCGCAGTC pLX_317 23.2% 90.6% 95.7% V5 (many diffs) n/a
Download CSV