Construct: ORF TRCN0000471824
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008526.1_s317c1
- Derived from:
- ccsbBroadEn_01764
- DNA Barcode:
- TCACGTACGTACGATATGCACGAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VDAC1 (7416)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471824
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7416 | VDAC1 | voltage dependent anion cha... | NM_003374.3 | 100% | 100% | |
| 2 | human | 7416 | VDAC1 | voltage dependent anion cha... | XM_005272075.3 | 100% | 100% | |
| 3 | human | 7416 | VDAC1 | voltage dependent anion cha... | XM_017009821.1 | 100% | 100% | |
| 4 | human | 7416 | VDAC1 | voltage dependent anion cha... | XM_017009822.1 | 100% | 100% | |
| 5 | human | 7416 | VDAC1 | voltage dependent anion cha... | XM_017009823.1 | 100% | 100% | |
| 6 | human | 7416 | VDAC1 | voltage dependent anion cha... | NR_036624.2 | 45.2% | 1_125del;975_1877del | |
| 7 | human | 7416 | VDAC1 | voltage dependent anion cha... | NR_036625.2 | 45.1% | 1_128del;978_1880del | |
| 8 | mouse | 22333 | Vdac1 | voltage-dependent anion cha... | NM_011694.5 | 89.8% | 98.5% | (many diffs) |
| 9 | mouse | 22333 | Vdac1 | voltage-dependent anion cha... | XM_017314500.1 | 69.6% | 76.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 915
- ORF length:
- 849
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tgtgccaccc acgtatgccg atcttggcaa atctgccagg gatgtcttca 121 ccaagggcta tggatttggc ttaataaagc ttgatttgaa aacaaaatct gagaatggat 181 tggaatttac aagctcaggc tcagccaaca ctgagaccac caaagtgacg ggcagtctgg 241 aaaccaagta cagatggact gagtacggcc tgacgtttac agagaaatgg aataccgaca 301 atacactagg caccgagatt actgtggaag atcagcttgc acgtggactg aagctgacct 361 tcgattcatc cttctcacct aacactggga aaaaaaatgc taaaatcaag acagggtaca 421 agcgggagca cattaacctg ggctgcgaca tggatttcga cattgctggg ccttccatcc 481 ggggtgctct ggtgctaggt tacgagggct ggctggccgg ctaccagatg aattttgaga 541 ctgcaaaatc ccgagtgacc cagagcaact ttgcagttgG CTACAAGACT GATGAATTCC 601 AGCTTCACAC TAATGTGAAT GACGGGACAG AGTTTGGCGG CTCCATTTAC CAGAAAGTGA 661 ACAAGAAGTT GGAGACCGCT GTCAATCTTG CCTGGACAGC AGGAAACAGT AACACGCGCT 721 TCGGAATAGC AGCCAAGTAT CAGATTGACC CTGACGCCTG CTTCTCGGCT AAAGTGAACA 781 ACTCCAGCCT GATAGGTTTA GGATACACTC AGACTCTAAA GCCAGGTATT AAACTGACAC 841 TGTCAGCTCT TCTGGATGGC AAGAACGTCA ATGCTGGTGG CCACAAGCTT GGTCTAGGAC 901 TGGAATTTCA AGCATACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 961 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1021 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TCACGTACGT ACGATATGCA 1081 CGAGACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt